Alternaria arborescens and A. italica Causing Leaf Blotch on Celtis julianae in China

Abstract

Celtis julianae Schneid. is widely planted as a versatile tree species with ecological and economic significance. In September 2022, a leaf blotch disease of C. julianae was observed in Nanjing, Jiangsu, China, with an infection incidence of 63%. The disease led to severe early defoliation, significantly affecting the ornamental and ecological value of the host tree. The accurate identification of pathogens is imperative to conducting further research and advancing disease control. Koch’s postulates confirmed that the fungal isolates (B1–B9) were pathogenic to C. julianae. The morphology of the characteristics of the pathogen matched those of Alternaria spp. The internal transcribed spacer region (ITS), large subunit (LSU) and small subunit (SSU) regions of rRNA, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Alternaria major allergen gene (Alt a 1), RNA polymerase second largest subunit (RPB2), and portions of translation elongation factor 1-alpha (TEF1-α) genes were sequenced. Based on multi-locus phylogenetic analyses and morphology, the pathogenic fungi were identified as Alternaria arborescens and A. italica. The findings provided useful information for disease management and enhanced the understanding of Alternaria species diversity in China. This is the first report of A. arborescens and A. italica causing leaf blotch of C. julianae in China and worldwide.

1. Introduction

Celtis julianae Schneid. (Ulmaceae) is a large deciduous tree that can reach a height of over 25 m. It serves as a valuable landscaping and shelter tree species due to its ability to withstand soot and toxic gases [1]. Additionally, its kernels are used as raw material for soap and lubricating oil production due to their high oil content. The numerous hairs on leaf surfaces enable it to trap airborne particulates, contributing to air purification [2]. In September 2022, a leaf blotch disease was observed on C. julianae at Nanjing Forestry University (118°48′26″ E, 32°4′52″ N). The disease led to early defoliation in severe cases, resulting in a reduction of its ornamental and ecological value.

The Alternaria genus comprises approximately ca. 382 species separated into 29 sections [3,4,5,6]. Alternaria species are crucial invasive pathogen that can colonize a wide range of hosts, including various plants in the phyllosphere, and animals, including humans [3,7,8,9,10]. Over 4000 monocotyledonous and dicotyledonous plant species are affected by Alternaria spp. [3,6,11,12,13]. For example, A. alternata (Fr.) Keissler is known to cause leaf spots on Prunus salicina [14]. In Oman, several species of Alternaria are associated with leaf spots on date palm and wheat produce, leading to reduced market value and significant economic losses [15]. Additionally, A. arborescens E.G. Simmons has been reported to cause leaf spots on Pereskia aculeata in Brazil [16]. In addition, the conidia of Alternaria are the most common airborne allergens and have been determined to be significant triggers of allergic rhinitis and allergic asthma [17,18]. Furthermore, Alternaria species have emerged as important human invasive pathogens in immune-compromised patients [19,20]. Thus, the Alternaria species deserves further studies.

The traditional identification of plant pathogenic fungi has mainly relied solely on morphological characteristics and host association. However, when relying solely on morphological characteristics, such as conidia, conidiophores, conidiogenous cells, and fruiting body, the pathogenic fungi may not be accurately classified and determined. Phylogenetic analyses have been widely applied for decades, leading to the discovery of numerous new species [21,22,23]. Initially, the internal transcribed spacer region (ITS) was commonly used for taxonomic purposes. However, studies have pointed out the limitations of using ITS sequence data [24,25,26]. In many fungal genera, the ITS locus only resolves taxa to the genus level due to the intraspecific and even intragenomic polymorphisms commonly observed [27,28]. Moreover, a substantial percentage of ITS sequences in GenBank are derived from misidentified specimens or cultures [29,30]. As a result, secondary DNA barcodes have been proposed for various genera of plant pathogenic fungi [31,32,33]. Nowadays, multi-locus phylogenetic analysis is considered more appliable and reliable in fungal taxonomy [34].

Similarly, Alternaria species were traditionally classified based on morphological characteristics of their reproductive structures and sporulation patterns under various conditions [35]. Alternaria spp. are dematiaceous fungi, exhibiting grey-olive/brown colonies. The conidia of Alternaria are dictyospores. These can either be found alone or in chains [36]. However, the subtle differences between Alternaria spp. and the morphological variation under different conditions can make identification based on solely on morphological characteristics challenging. With the advent of molecular analyses, researchers have examined phylogenetic relationships among Alternaria species. Lawrence et al. [12,18] first determined 27 sections in Alternaria through multi-locus phylogeny. Woudenberg et al. [6] used six loci to establish 24 sections, including 16 newly described sections. By combining seven loci, a consensus phylogeny was generated. Ghafri et al. [37] introduced Alternaria section Omanenses in 2019, and Gannibal et al. [38] introduced Alternaria section Helianthiinficiens in 2022, bring the total number of Alternaria species to 29 sections. Currently, a clear and stable phylogenetic classification has been established at the species level among Alternaria spp., providing a reliable basis for this study.

The objectives of this study were (1) to isolate and identify the pathogen of leaf blotch on C. julianae according to morphological characteristics and multilocus phylogenetic analyses, and (2) to confirm the pathogenicity of the isolates on C. julianae.

2. Results

2.1. Disease Symptoms and Fungal Isolations

The leaf blotch disease was observed on C. julianae at the campus of Nanjing Forestry University, China, with an incidence of 63% (63/100 plants). On average, 80% of the leaves per tree showed the presence of this leaf blotch disease (Figure 1A,B). The symptoms initially appeared as small, light brown spots. Measuring 1–2 mm in diameter, they were surrounded by yellow halos (Figure 1C). Subsequently, the spots gradually expanded into irregular necrotic blotches with dark brown borders, and the halos developed around the dark brown borders, leading to an increase in the size of the blotches over time (Figure 1D). Eventually, the blotches coalesced into large necrotic areas, resulting in leaf shrinkage, wrinkling, and collapse (Figure 1E). Numerous brown conidial chains were observed on the lesions of infected leaves (Figure 1F,G).

Diseased leaves were collected twice for isolating fungal pathogens in September and in October 2022, respectively. In the September experiment, three types of colonies were found with a frequency of 63%, 24%, and 13%, respectively. Similarly, in the October experiment, three types of colonies were found with a frequency of 54%, 38%, and 8%, respectively. According to the ITS sequence alignment, the three types of colonies belonged to the genera Nigrospora, Alternaria and Nothophoma, respectively (

Table 1. Fungi isolated from diseased leaves of Celtis julianae.

Month	Number of Tissues	Number of Colonies
		Nigrospora sp.	Alternaria sp.	Nothophoma sp.
September	100	50 (63%)	19 (24%)	10 (13%)
October	100	47 (54%)	33 (38%)	7 (8%)

).

2.2. Pathogenicity Tests

Five days post-inoculation in vitro, all detached leaves inoculated with nine isolates (B1–B9) of Alternaria spp. appeared to display brown spot symptoms at the inoculation sites, whereas leaves inoculated with Nigrospora sp., Nothophoma sp. and control leaves did not show any symptoms. Subsequently, in vivo experiments were conducted that used three representative fungal isolates (B1, B2 and B3) of the Alternaria species to inoculate healthy C. julianae seedlings. Seven days after inoculation, the inoculated leaves appeared to be brown spots with yellow halos, resembling the early symptoms observed on the leaves infected in the field. In contrast, the control leaves remained healthy (Figure 2). The same fungus was re-isolated from the lesions, and no other fungi were isolated from the control leaves. This fulfills Koch’s postulates, confirming that isolates B1, B2 and B3 are the causal agents of leaf blotch on C. julianae.

2.3. Multigene Phylogenetic Analyses

Phylogenetic analyses performed using maximum-likelihood and Bayesian inference techniques placed the four isolates (B3, B4, B5, and B6) in the same cluster with Alternaria italica J.F. Li, Camporesi & K.D. Hyde (extype: MFLUCC 14-0421T). Meanwhile, there were five isolates (B1, B2, B7, B8, and B9) in the same cluster with A. arborescens (extype: CBS 102605) (Figure 3). The phylogenetic trees generated using ML and BI methods showed consistent topology. Based on the phylogenetic analyses conducted using the concatenated sequences of seven genes/regions (ITS, LSU, SSU, GAPDH, Alt a 1, RPB2 and TEF1-α), B1, B2, B7, B8, and B9 were identified as A. arborescens, while B3, B4, B5, and B6 were determined to be A. italica.

2.4. Morphology and Taxonomy

• Alternaria arborescens E.G. Simmons (Figure 4)

Culture characteristics: On potato–carrot agar (PCA) and V8 agar (V-8), colonies of isolate B1 were circular, flat, and granulated with undulating edges. The colony was grayish green, and the reverse side was greenish brown (Figure 4A,B).

Description: Sexual morph not observed. Under the Zeiss Axio Imager A2m microscope (Carl Zeiss AG, Oberkochen Germany), the hyphae were hyaline to light brown, septate, and (3.0−)3.7 − 5.3(−7.1) μm (mean ± SD = 4.5 ± 0.8 μm, n = 30) wide. Conidiophores were solitary, dark brown, straight or curved, 2–8 septa, and variable in length, (32.7−)41.5 − 94.3(−121.6) × (3.2−)3.7 − 4.7(−5.3) μm (mean ± SD = 67.9 ± 26.4 × 4.2 ± 0.5 μm, n = 30) (Figure 4C,D). Conidiogenous cells (5.5−)6.2 − 9.2(−11.8) × (3.4−)4.0 − 4.8(−5.0) μm (mean ± SD = 7.7 ± 1.5 × 4.4 ± 0.4 μm, n = 30). Conidia were oval or obclavate, brown to dark brown, with 1–4 transverse septa and 1–4 longitudinal or oblique septa, constricted at the septa, (19.7−)23.6 − 28.4(−34.3) × (9.8−)11.0 − 12.8(−13.7) μm (mean ± SD = 26.0 ± 2.4 × 11.9 ± 0.9 μm, n = 30) (Figure 4E). The beaks (2.7−)3.3 − 5.1(−6.4) × (2.8−)3.4 − 4.4(−4.9) μm (mean ± SD = 4.2 ± 0.9 × 3.9 ± 0.5 μm, n = 30). Conidial chains were simple or branched with 1–15 conidia. (Figure 4F).

Specimens examined: China, Jiangsu province, Nanjing city, isolated from leaves of Celtis julianae, 1 September 2022, Yijia Cao, cultures: CFCC 59038 (=B1), CFCC 59039 (=B2), B7, B8 and B9.

Notes: The phylogenetic analyses showed that five isolates (B1, B2, B7, B8 and B9) were in a clade with A. arborescens (Figure 3). The morphological features of the five isolates matched those of A. arborescens [39]. Based on the morphology and phylogeny, B1, B2, B7, B8 and B9 were identified as A. arborescens.

• Alternaria italica J.F. Li, Camporesi & K.D. Hyde (Figure 5)

Culture characteristics: On PCA and V-8 media, the colony appears flat with gray margin. It is greyish green and cottony, covering the Petri dish after 7 days and showing abundant sporulation. The reverse side is dark greyish-green and radial (Figure 5A,B). After a week, the culture has increased the amount of white aerial mycelium in the center of the plate.

Description: Sexual morph not observed. The hyphae were colorless, hyaline to light brown, septate, (3.2−)3.6 − 5.0(−5.7) μm (mean ± SD = 4.3 ± 0.7 μm, n = 30) wide. Conidiophores macronematous, mononematous, flexuous or sigmoid, 0–5 septate, simple or branched, smooth, and hyaline to light brown, (13.5−)20.1 − 36.7(−46.2) × (3.1−)3.8 − 4.8(−5.3) μm (mean ± SD = 28.4 ± 8.3 × 4.3 ± 0.5 μm, n = 30) (Figure 5D,E). Lateral secondary conidiophores were observed but relatively uncommon. Conidiogenous cells were at the tip of conidiophores, (4.8−)5.8 − 8.0(−10.1) × (3.4−)3.8 − 4.8(−6.2) μm (mean ± SD = 6.9 ± 1.1 × 4.3 ± 0.5 μm, n = 30). Conidial chains were commonly single file, occasionally branched with 2–8 conidia (Figure 5C,D). Conidia dictyospores, pale brown to brown, variable in size and shape, but often obclavate to obpyriform, with up to 8 transverse and usually 0–2 longitudinal or oblique septa, slightly constricted at the septa, (27.7−)29.6 − 40.0(−51.3) × (7.6−)8.2 − 10.8(−13.1) μm (mean ± SD = 34.8 ± 5.2 × 9.5 ± 1.3 μm, n = 30) (Figure 5C). The apex of the conidia bears a beak, pale brown, most of the beaks are relatively short and well rounded, (3.1−)4.0 − 8.2(−12.2) × (3.1−)3.5 − 4.3(−5.1) μm (mean ± SD = 6.1 ± 2.1 × 3.9 ± 0.4 μm, n = 30).

Specimens examined: China, Jiangsu province, Nanjing city, isolated from leaves of Celtis julianae, 1 September 2022, Yijia Cao, cultures: CFCC 59359 (=B3), CFCC 59309 (=B4), CFCC 59310 (=B5), and CFCC 59311 (=B6).

Notes: The phylogenetic analyses showed that four isolates (B3, B4, B5 and B6) clustered together with A. italica (Figure 3). Morphological features of the four isolates matched those of A. italica [40]. Based on morphology and phylogeny, B3, B4, B5 and B6 were identified as A. italica.

3. Discussion

The genus Alternaria was first described by Nees von Esenbeck (1816), with A. tenuis as the type of species. Historically, the identification and classification of Alternaria species heavily relied on measurements and descriptions of morphological characteristics [41], complemented later by molecular phylogeny [42,43]. However, recent studies have challenged the morphological basis for the identification of some species in Alternaria [11,13,44]. Currently, the genus Alternaria contains 29 sections, and the main morphological characteristic of Alternaria sect. Alternaria is the production of short conidia in chains [6,18,45]. Woudenberg et al. [6] established species in Alternaria sect. Alternaria based on ITS. Subsequent whole-genome sequencing, transcriptome comparisons, and multi-gene sequencing further rearranged Alternaria sect. Alternaria into 11 phylogenetic species and one species complex [13]. Following a number of studies conducted by Li et al. [3,4], Cannibal et al. [45,46], Wanasinghe et al. [47], Jayawardena et al. [48] and Nishikawa et al. [49], currently over 89 species constitute the sect. Alternaria. Traditional morphological methods with molecular phylogeny are vital for identifying Alternaria species. In this study, a multi-locus phylogeny based on a concatenated ITS, LSU, SSU, GAPDH, Alt a 1, RPB2 and TEF1-α sequences, combined with morphological characteristics, revealed two known species, A. arborescens and A. italica, within the sect Alternaria. Additionally, our study also reported new host records for A. arborescens and A. italica. It is worth noting that many pathogenic fungal species are named after their hosts, and that the two Alternaria species identified in this study belong to the same section and is isolated from the same host. The similarities in their morphological features highlight the importance of taking cautious approaches in identifying and naming Alternaria species.

Alternaria is among the primary mycotoxigenic fungal genera found in cereals worldwide [50]. It can produce a variety of mycotoxins derived from secondary metabolism, with about 70 toxic metabolites described so far [35]. Some pathogenic Alternaria spp. utilize a diverse array of pathogenic toxins to infect plant tissues [51,52]. Certain species of Alternaria produce host-specific toxins (HSTs) that influence their pathogenicity and virulence. For example, the Japanese pear pathotype associated with Alternaria produces AK toxins I and II, which only exhibit toxicity in susceptible pear cultivars [35]. In addition, HSTs affect the taxonomy of the genus as fungal systematics include the analysis of secondary metabolites, providing information for use in species differentiation. At present, several researchers have employed chemotaxonomy and pathogenicity characteristics to assist with classification [53,54,55]. However, the method cannot be used independently for classification, because members within the same group may not share a common metabolite profile [50]. Therefore, the application of polyphasic approaches could provide strong support in fungal taxonomy, and further studies are warranted.

In our study, we observed that the isolation rates of Nigrospora spp. were consistently higher than those of Alternaria spp. in two independent fungal isolations. However, coexistence observation and pathogenicity testing showed that Alternaria spp. was the pathogen causing leaf blotching of C. julianae. Previous studies have indicated that species the of genus Nigrospora possess a strong saprobic nature and commonly occur as plant endophytes or saprobes on different hosts [56,57]. Nigrospora spp. may have more advantages in competing for nutrients in substrates compared to Alternaria spp., which can slow the growth of Alternaria. This could be the reason for the higher isolating rates of Nigrospora than those of Alternaria spp.

Celtis julianae is an important ornamental species mainly found in the temperate biome, with its native range overlaying the central and southern parts of China [58]. It has a high level of wind resistance due to its deep roots, making it an ideal species for embankment protection and water conservation [59]. Additionally, C. julianae helps maintain air humidity, reduce heat, and create various shadows with its large and dense leaves [60]. Economically, C. julianae has rich bark fiber, which can be used for making paper, and the core of its fruit can be used in oil and soap manufacture. In summary, C. julianae is a multi-functional species with ornamental, ecological and economic value. Currently, research on diseases affecting C. julianae is insufficient. Therefore, the investigation of leaf blotch on C. julianae and identification of pathogens have significance in providing the theoretical basis for reducing the economic and ecological losses caused by this disease.

4. Materials and Methods

4.1. Sampling and Isolation of Fungi

From September to October 2022, the isolation of fungi was conducted twice. Each time, 25 symptomatic leaves were collected from three infected plants on the campus of Nanjing Forestry University. The symptomatic leaves were first rinsed under running water and dried on sterilized filter paper. One-hundred small tissue (3 × 3 mm) samples were cut from lesion margins and surface-sterilized in 75% ethanol for 30 s, followed by the use of 1% NaClO for 90 s. The samples were then rinsed 3 times in sterile water, dried on sterilized filter paper, and finally plated onto potato dextrose agar (PDA) supplemented with ampicillin. The plates were incubated at 25 °C in an incubator, MIR-553 (Sanyo, Osaka Japan) [61]. After 3 days, the growing edges of the mycelium from the plant materials were cut and transferred to fresh PDA media to obtain a pure culture [62].

4.2. Pathogenicity Tests

To determine the pathogenicity of the isolates, experiments were conducted on both detached leaves and attached leaves. Healthy leaves from the field were collected, rinsed under tap-water for 15 min, and then wounded with sterile needles after drying on sterilized filter paper. For each type of test, two isolates were selected. For inoculation, plugs (5 mm diam.) were cut out from the growing edges of 5-day-old cultures and placed onto the wounds. The PDA plugs were used as controls. Five wounded leaves were treated with isolate and control plug. After inoculation, the leaves were placed into Petri dishes to maintain their humidity and kept at 25 °C in an incubator. Subsequently, nine representative fungal isolates (B1–B9) were selected from pathogenic species for in vivo inoculation with mycelial plugs. To confirm Koch’s postulates, further pathogenicity tests were performed by inoculating conidial suspensions on leaves of C. julianae seedlings that were wounded with a sterile needle. The leaves were inoculated with the three representative isolates (B1–B3) using 10 µL of conidial suspensions (10⁶ conidia/mL). Five plants were used for each treatment, and three leaves of each plant were inoculated. The control was treated with 10 µL of sterile water. All inoculated seedlings were covered with plastic bags, and sterilized water was sprayed into the bags daily to maintain a moist microclimate. All seedlings were kept in a growing chamber at 20 ± 2 °C/10 ± 2 °C (day/night) and observed regularly. Leaves that showed typical symptoms after the inoculation were used for re-isolations.

4.3. DNA Extraction and PCR Amplification

Nine isolates were cultured on potato dextrose agar (PDA), V8 agar (V-8) and potato–carrot agar (PCA) media at 25 °C in a constant temperature incubator with a 12/12 h light/dark cycle. Morphological identification was based on colony morphology and characteristics of conidia, conidiophores, conidiogenous cells, such as the shape and color of the colony, as well as the shape, size, color, septation, and presence of a beak in the conidia. A Zeiss Axio Imager A2m microscope (Carl Zeiss AG, Oberkochen Germany) and Zeiss stereo microscope (SteRo Discovery v20) were used to observe, describe, and measure conidia and other structures (n = 30).

4.4. Morphological Identification

For accurate pathogen identification, the genomic DNA was extracted using a modified CTAB method [63]. The internal transcribed spacer (ITS) [64], large subunit (LSU) and small subunit (SSU) regions of rRNA [64,65], glyceraldehyde-3-phosphate dehydrogenase (GAPDH) [66], Alternaria major allergen gene (Alt a 1) [67], RNA polymerase second largest subunit (RPB2) [68] and portions of translation elongation factor 1-alpha (TEF1-α) [69] genes/region were sequenced using primers ITS1/4, LR0R/LR05, NS1/NS4, GPD1/GPD2, Alt-for/Alt-rev, RPB2-5F2/RPB2-7cR and EF1-728F/EF1-986R, respectively. PCR was carried out in a 50 µL reaction mixture containing 2 µL DNA; 2 µL of 10 µM primer, both forward and reverse (

Table 2. Primers used for PCR amplification in molecular identification of nine isolates (B1–B9).

Locus	Primers	Primer Sequences (5′-3′)	Advantages and Limitations	Reference
ITS	ITS1	TCCGTAGGTGAACCTGCGC	Universal fungal barcode, contains greater sequence variation, evolves faster, intragenomic variation gives the slow homogenization among the various copies	[64]
	ITS4	TCCTCCGCTTATTGATATGC
LSU	LROR	ACCCGCTGAACTTAAGC	Conserved and variable domain, low rate of molecular evolution reduces the taxonomic resolution at the species-level	[65]
	LR5	TCCTGAGGGAAACTTCG
SSU	NS1	GTAGTCATATGCTTGTCTC		[64]
	NS4	CTTCCGTCAATTCCTTTAAG
GAPDH	GPD1	CAACGGCTTCGGTCGCATTG	Highly effective for heterologous protein expression in microorganisms, the expression level may increase under inducing treatments	[66]
	GPD2	GCCAAGCAGTTGGTTGTGC
Alt a 1	Alt-al-for	ATGCAGTTCACCACCATCGC	A gene for the Alternaria major allergen, supports grouping of Alternaria spp. and related taxa	[67]
	Alt-a1-rev	ACGAGGGTGAYGTAGGCGTC
RPB2	RPB2-5F2	GGGGWGAYCAGAAGAAGGC	Recover well-supported clades at shallow and deep taxonomic levels and has a better species-resolving power than rDNA markers	[68]
	RPB2-7cR	CCCATRGCT TGT YYRCCCAT
TEF1-α	EF1-728F	CATCGAGAAGTTCGAGAAGG	Recover some deep and ordinal-level relationships but with greater branch support from nucleotides	[69]
	EF1-986R	TACTTGAAGGAACCCTTACC

); 25 µL of Taq DNA polymerase mix; and 19 µL double-distilled water. The PCR amplifications were carried out with the following cycling parameters: initial denaturation at 94 °C for 3 min, followed by 33 cycles of 30 s at 94 °C, annealing at a suitable temperature for 30 s for different loci: 55 °C for ITS, 52.4 °C for LSU, 53 °C for SSU and RPB2, 59.5 °C for GAPDH, 60.5 °C for Alt a 1, extension at 72 °C for 30 s, and a final elongation at 72 °C for 10 min. The cycling parameter for TEF1-α was as follows: 94 °C for 5 min; 40 cycles at 94 °C for 30 s; 59 °C for 30 s; 72 °C for 45 s; and a final extension at 72 °C for 7 min. The PCR products were sequenced at Sangon Biotech Co., Ltd. (Nanjing, China).

4.5. Multigene Phylogenetic Analyses

The obtained sequences were analyzed using BLAST (https://www.ncbi.nlm.nih.gov/, accessed on 2 August 2023) to retrieve sequences with high similarities to the query sequences. Seventy-one isolates of 45 Alternaria species were obtained from GenBank for phylogenetic use in analyses (

Table 3. Isolates of Alternaria spp. used in this study and corresponding GenBank accession numbers.

Species	Isolate	Locality, Host/Substrate	Accession Numbers
			ITS	LSU	SSU	GAPDH	Alt a 1	RPB2	TEF1-α
Alternaria alstroemeriae	CBS 118808	USA, Alstroemeria sp.	KP124296	KP124447	KP124917	KP124153	KP123845	KP124764	KP125071
A. alternantherae	CBS 124392	China, Solanum melongena	KC584179	KC584251	KC584506	KC584096	KP123846	KC584374	KC584633
A. alternata	CBS 916.96	India, Arachis hypogaea	AF347031	DQ678082	KC584507	AY278808	AY563301	KC584375	KC584634
A. alternata	CBS 112249	-, -	KP124338	KP124490	KP124960	KP124192	KP123886	KP124806	KP125114
A. arborescens	CBS 102605	USA, Solanum lycopersicum	AF347033	KC584253	KC584509	AY278810	AY563303	KC584377	KC584636
A. arborescens	B1 = CFCC 59038 *	China, Celtis julianae	OQ691659	OQ692430	OQ692438	OQ710109	OQ710107	OQ710111	OQ710113
A. arborescens	B2 = CFCC 59039 *	China, Celtis julianae	OQ691640	OQ692431	OQ692439	OQ710110	OQ710108	OQ710112	OQ710114
A. arborescens	B7 *	China, Celtis julianae	OR243734	OR366490	OR366484	OR475216	OR475232	OR475224	OR475210
A. arborescens	B8 *	China, Celtis julianae	OR243735	OR366491	OR366485	OR475217	OR475231	OR475225	OR475211
A. arborescens	B9 *	China, Celtis julianae	OR243736	OR366492	OR366486	OR475218	OR475233	OR475226	OR475212
A. arborescens	CBS 119545	New Zealand, Senecio skirrhodon	KP124409	KP124562	KP125032	KP124260	KP123956	KP124879	KP125187
A. arctoseptata	MFLUCC 21-0139	Italy, Lathyrus sp. (Fabaceae)	-	MZ621948	MZ621874	0K236608	OK236755	OK236655	OK236702
A. avenicola	CBS 121459	Norway, Avena sp.	KC584183	KC584256	KC584512	KC584100	-	KC584380	KC584639
A. axiaeriisporifera	CBS 118715	New Zealand, Gypsophila paniculata	KC584184	KC584257	KC584513	KC584101	-	KC584381	KC584640
A. baoshanensis	MFLUCC 21-0124	China, Curcubita moschata	MZ622003	MZ621952	MZ621878	OK236613	OK236760	OK236659	OK236706
A. betae-kenyensis	CBS 118810	Kenya, Beta vulgaris var. cicla	KP124419	KP124572	KP125042	KP124270	KP123966	KP124888	KP125197
A. brassicae	CBS 116528	USA, Brassica oleracea	KC584185	KC584258	KC584514	KC584102	-	KC584382	KC584641
A. brassicicola	CBS 118699	USA, Brassica oleracea	JX499031	KC584259	KC584515	KC584103	-	KC584383	KC584642
A. breviconidiophora	MFLUCC 22-0075	Italy, Digitalis sp. (Scrophulariaceae)	MZ621997	MZ621944	MZ621870	OK236604	OK236751	OK236651	OK236698
A. burnsii	CBS 107.38	India, Cuminum cyminum	KP124420	KP124573	KP125043	JQ646305	KP123967	KP124889	KP125198
A. carotiincultae	CBS 109381	USA, Daucus carota	KC584188	KC584262	KC584518	KC584106	-	KC584386	KC584645
A. cinerariae	CBS 116495	USA, Ligularia sp.	KC584190	KC584265	KC584521	KC584109	-	KC584389	KC584648
A. conoidea	CBS 132.89	Saudi Arabia, Ricinus communis	FJ348226	KC584327	KC584585	FJ348227	FJ348228	KC584452	KC584711
A. dauci	CBS 117097	USA, Daucus carota	KC584192	KC584268	KC584524	KC584111	KJ718678	KC584392	KC584651
A. doliconidium	KUN-HKAS 100840T	Italy, Rosa canina	NR158361	NG069551	NG065142	-	-	-	-
A. eichhorniae	CBS 489.92	India, Eichhornia crassipes	KC146356	KP124579	KP125049	KP124276	KP123973	KP124895	KP125204
A. ellipsoidea	CBS 119674	USA, Dianthus barbatus	KC584196	KC584272	KC584528	KC584115	-	KC584396	KC584655
A. ellipsoidialis	MFLUCC 21-0132	Italy, Brassica sp. (Brassicaceae)	MZ621989	MZ621936	MZ621862	OK236596	OK236743	OK236643	OK236690
A. eupatoriicola	MFLUCC 21-0122	Italy, Eupatorium cannabinum (Asteraceae)	MZ621982	MZ621929	MZ621855	OK236589	OK236736	OK236636	OK236683
A. falcata	MFLUCC 21-0123	Italy, Atriplex sp. (Chenopodiaceae)	MZ621992	MZ62139	MZ621865	OK236599	OK236746	OK236649	OK236693
A. gaisen	CBS 118488	Japan, Pyrus pyrifolia	KP124427	KP124581	KP125051	KP124278	KP123975	KP124897	KP125206
A. gossypina	CBS 104.32	Zimbabwe, Gossypium sp.	KP124430	KP124584	KP125054	JQ646312	JQ646395	KP124900	KP125209
A. gypsophilae	CBS 107.41	Netherlands, Gypsophila elegans	KC584199	KC584277	KC584533	KC584118	KJ718688	KC584401	KC584660
A. helianthiinficiens	CBS 117370	UK, Helianthus annuus	KC584200	KC584278	KC584534	KC584119	-	KC584402	KC584661
A. helianthiinficiens	CBS 208.86	USA, Helianthus annuus	JX101649	KC584279	KC584535	KC584120	-	KC584403	EU130548
A. infectoria	CBS 210.86	UK, Triticum aestivum	DQ323697	KC584280	KC584536	AY278793	FJ266502	KC584404	KC584662
A. iridiaustralis	CBS 118486	Australia, Iris sp.	KP124435	KP124589	KP125059	KP124284	KP123981	KP124905	KP125214
A. italica	MFLUCC 14-0421T	Italy, Pleosporaceae	MG764017	MG818319	-	-	-	MG859737	-
A. italica	B3 = CFCC 59359 *	China, Celtis julianae	OR272062	OR366487	OR366480	OR475213	OR475227	OR475220	OR475207
A. italica	B4 = CFCC 59309 *	China, Celtis julianae	OR243731	OR366526	OR366481	OR475219	OR475228	OR475221	OR250485
A. italica	B5 = CFCC 59310 *	China, Celtis julianae	OR243732	OR366488	OR366482	OR475214	OR475229	OR475222	OR475208
A. italica	B6 = CFCC 59311 *	China, Celtis julianae	OR243733	OR366489	OR366483	OR475215	OR475230	OR475223	OR475209
A. jacinthicola	CBS 133751	Mali, Eichhornia crassipes	KP124438	KP124592	KP125062	KP124287	KP123984	KP124908	KP125217
A. juxtiseptata	CBS 119673	Australia, Gypsophila paniculata	KC584202	KC584282	KC584538	KC584122	-	KC584406	KC584664
A. lathyri	MFLUCC 21-0140	Italy, Lathyrus sp. (Fabaceae)	MZ621974	MZ621921	MZ621847	OK236581	OK236728	OK236628	OK236675
A. longipes	CBS 540.94	USA, Nicotiana tabacum	AY278835	KC584285	KC584541	AY278811	AY563304	KC584409	KC584667
A. macroconidia	MFLUCC 21-0134	Italy, Spartium junceum	MZ622001	MZ621950	MZ621876	OK236610	OK236757	OK236657	OK236704
A. macrospora	CBS 117228	USA, Gossypium barbadense	KC584204	KC584286	KC584542	KC584124	KJ718702	KC584410	KC584668
A. mimicula	CBS 118696	USA, Lycopersicon esculentum	FJ266477	KC584287	KC584543	AY562415	GQ180094	KC584411	KC584669
A. minimispora	MFLUCC 21-0127	Thailand, Citrullus lanatus	MZ621980	MZ621927	MZ621853	OK236587	OK236734	OK236634	OK236681
A. muriformispora	MFLUCC 22-0073	Italy, Plantago sp. (Plantaginaceae)	MZ621976	MZ621923	MZ621849	OK236583	OK236730	OK236630	OK236677
A. nobilis	CBS 116490	New Zealand, Dianthus caryophyllus	KC584208	KC584291	KC584547	KC584127	-	KC584415	KC584673
A. oblongoellipsoidea	MFLUCC 22-0074	Italy, Cichorium intybus	MZ621967	MZ621914	MZ621840	OK236574	OK236721	OK236621	OK236668
A. obpyriconidia	MFLUCC 21-0121	Italy, Vicia faba	MZ621978	MZ621925	MZ621851	OK236585	OK236732	OK236633	OK236680
A. orobanches	MFLUCC 21-0137	Italy, Orobanche sp.	MZ622007	MZ621956	MZ621882	-	OK236763	-	OK236710
A. ovoidea	MFLUCC 14-0427	Italy, Dactylis glomerata	MZ622005	MZ621954	MZ621880	OK236614	OK236761	OK236661	OK236708
A. perpunctulata	CBS 115267	USA, Alternanthera philoxeroides	KC584210	KC584294	KC584550	KC584129	JQ905111	KC584418	KC584676
A. petroselini	CBS 112.41	–, Petroselinum sativum	KC584211	KC584295	KC584551	KC584130	-	KC584419	KC584677
A. phragmiticola	MFLUCC 21-0125	Italy, Phragmites sp.	MZ621994	MZ621941	MZ621867	OK236602	OK236749	OK236649	OK236696
A. porri	CBS 116698	USA, Allium cepa	DQ323700	KC584297	KC584553	KC584132	KJ718726	KC584421	KC584679
A. pseudoinfectoria	MFLUCC 21-0126	Italy, Chenopodium sp.	MZ621984	MZ621931	MZ621857	OK236591	OK236738	OK236638	OK236685
A. pseudorostrata	CBS 119411	USA, Euphorbia pulcherrima	JN383483	KC584298	KC584554	AY562406	AY563295	KC584422	KC584680
A. radicina	CBS 245.67	USA, Daucus carota	KC584213	KC584299	KC584555	KC584133	FN689405	KC584423	KC584681
A. rostroconidia	MFLUCC 21-0136	Italy, Arabis sp.	MZ621969	MZ621916	MZ621842	OK236576	OK236723	OK236623	OK236670
A. salicicola	MFLUCC 22-0072	Russia, Salix alba	MZ621999	MZ621946	MZ621872	OK236606	OK236753	OK236653	OK236700
A. saponariae	CBS 116492	USA, Saponaria officinalis	KC584215	KC584301	KC584557	KC584135	-	KC584425	KC584683
A. selini	CBS 109382	Saudi Arabia, Petroselinum crispum	AF229455	KC584302	KC584558	AY278800	FJ266504	KC584426	KC584684
A. septorioides	CBS 106.41	Netherlands, Reseda odorata	KC584216	KC584303	KC584559	KC584136	-	KC584427	KC584685
A. setosa	YZU 191101	China, Iris japonica	OP2341770	-	-	OP352306	OP352294	OP352294	OP374459
A. smyrnii	CBS 109380	UK, Smyrnium olusatrum	AF229456	KC584305	KC584561	KC584138	-	KC584429	KC584687
A. solani	CBS 116651	USA, Solanum tuberosum	KC584217	KC584306	KC584562	KC584139	GQ180097	KC584430	KC584688
A. solidaccana	CBS 118698	Bangladesh, Soil	KC584219	KC584308	KC584564	KC584141	-	KC584432	KC584690
A. sonchi	CBS 119675	Canada, Sonchus asper	KC584220	KC584309	KC584565	KC584142	-	KC584433	KC584691
A. tectorum	YZU 161050	China, Iris tectorum	OP341728	-	-	OP352303	OP293714	OP352291	OP374456
A. tectorum	YZU 161052	China, Iris tectorum	-	-	OP341817.1	OP352304.1	OP293715.1	OP352292.1	OP374457.1
A. tomato	CBS 103.30	Unknown, Solanum lycopersicum	KP124445	KP124599	KP125069	KP124294	KP123991	KP124915	KP125224
A. torilis	MFLUCC 14-0433	Italy, Torilis arvensis	MZ621988	MZ621935	MZ621861	OK236594	OK236741	OK236641	OK236688
A. vaccariae	CBS 116533	USA, Vaccaria hispanica	KC584223	KC584314	KC584570	KC584146	JQ646386	KC584438	KC584696
A. vaccariicola	CBS 118714	USA, Vaccaria hispanica	KC584224	KC584315	KC584571	KC584147	JQ646384	KC584439	KC584697
A. vitis	MFLUCC 17-1109T	Chile, China, El Salvador, Greece, India, Italy, Romania, Russia, Thailand, Turkmenistan, Pleosporaceae	MG764007	-	-	-	-	-	-

* Isolates in this study. Ex-type cultures are shown in bold. Abbreviations: CBS: Culture collection of the Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; CFCC: China Forestry Culture Collection Center, Beijing, China; KUN-HKAS: Herbarium of Cryptogams Kunming Institute of Botany Academia Sinica, Yunnan, China; MFLUCC: Mae Fah Luang University Culture Collection, Chiang Rai, Thailand; YZU: Fungal Herbarium of Yangtze University, Jingzhou, Hubei, China.

). The sequences of each gene/region were aligned with MAFFT ver. 7.313 (https://mafft.cbrc.jp/alignment/server, accessed on 2 August 2023) and manually adjusted using BioEdit ver. 7.0 [70,71]. The seven genes/region were concatenated by PhyloSuite ver. 7.313 [72]. ModelFinder was used to select the best-fit model, and phylogenetic relationships were inferred using maximum-likelihood (ML) analysis in IQtree ver. 1.6.8 and Bayesian inference (BI) in MrBayes 3.2.6 [73,74,75]. The ML analysis used the best model: GTR + I + G4 + F, with 1000 bootstrap replicates. The BI analysis used the best model: SYM + I + G, with 2 parallel runs and 2,000,000 generations, discarding the initial 25% of sampled data as burn-in. Phylogenetic trees were visualized using FigTree ver. 1.4.3 (https://tree.bio.ed.ac.uk/software/figtree/, accessed on 2 August 2023).

5. Conclusions

In the present study, we conducted fungal pathogen isolation and pathogenicity tests. We identified the nine fungal isolates (B1–B9) obtained, which are causing leaf blotch of C. julianae, based on multi-locus phylogenetic analyses using loci of ITS, LSU, SSU, GAPDH, Alt a 1, RPB2, TEF1-α, and morphological characteristics. The isolates were determined to be A. arborescens and A. italica within the Alternaria section Alternaria. To the best of our knowledge, this is the first report of A. arborescens and A. italica causing leaf blotch of C. julianae in either China or the wider world. The results of the study provide imperative and fundamental information for understanding the disease and performing future studies on the fungi/pathogens and the disease from mycological and phytopathological aspects. It is the first step in advancing the management of the disease.