Zootaxa 4450 (4): 427–444 http://www.mapress.com/j/zt/ ISSN 1175-5326 (print edition) Article Copyright © 2018 Magnolia Press ZOOTAXA ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4450.4.2 http://zoobank.org/urn:lsid:zoobank.org:pub:D62364EC-2DEA-462B-BC9B-1AD557BA785A Detection of Cryptic taxa in the genus Leptophryne (Fitzinger, 1843) (Amphibia; Bufonidae) and the description of a new species from Java, Indonesia AMIR HAMIDY1,5, MISBAHUL MUNIR1,2, MUMPUNI1, MILA RAHMANIA3 & AZIS ABDUL KHOLIK4 1 Museum Zoologicum Bogoriense, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Gd. Widyasatwaloka, Jl. Raya Jakarta-Bogor km 46, Cibinong, West Java, Indonesia 2 Study Group of Wildlife and Habitat Conservation “Green Community”, Department of Biology, Faculty of Mathematic and Natural Sciences, Semarang State University, Semarang, Indonesia 3 Department of Tropical Biodiversity Conservation, Graduate School of Bogor Agricultural University, Bogor, West Java, Indonesia. 4 Gunung Ciremai National Park, Jl. Raya Kuningan km 9 No. 1, Cirebon, West Java, Indonesia. 5 Corresponding author. E-mail:hamidyamir@gmail.com or amir.hamidy@lipi.go.id Abstract We investigated phylogenetic relationships among populations of two species within the genus Leptophryne, L. cruentata and L. borbonica, using the mitochondrial 16S rRNA gene. As a result, we identified two distinct lineages within populations currently considered Leptophryne cruentata: 1) a lineage containing L. cruentata from the type locality, and 2) a lineage from Mt. Slamet and Mt. Ciremai. On the basis of genetic and morphological differences, we describe the Mt. Slamet and Mt. Ciremai populations as a new species, L. javanica sp. nov. The new species is distinguished from L. cruentata and L. borbonica by the following combination of morphological characters: the presence of distinct yellow mottling on the dorsum; relatively small body size (SVL male 22.2–24.0 mm, female 29.6 mm); relatively short hindlimbs (HLL 37.0–40.9 mm); relatively short fourth toe (4ToeL 4.3–6.0 mm); basal webbing on the hands, but well developed on toes; very protruding snout and an indistinct tympanum. In our preliminary phylogenetic analysis, we also detected four distinct lineages within Leptophryne borbonica: 1) a lineage containing true L. borbonica from west Java, 2) a lineage from Lampung (Sumatra I), 3) a lineage from northern Borneo, and 4) a lineage from Bengkulu (Sumatra II). Further studies are needed to determine taxonomic status of these lineages. Key words: Leptophryne javanica, new species, Sundaland, taxonomy Introduction Fitzinger (1843) proposed the genus Leptophryne with L. cruentata, formerly known as Bufo cruentatus (Tschudi, 1838), as the type species. At present, this genus contains two species, Leptophryne cruentata (Tschudi, 1838) and Leptophryne borbonica (Tschudi, 1838). The type locality of L. cruentata is Cibereum, situated on the northern slope of Mount (Mt.) Gede, West Java, and the type locality of L. borbonica is also in West Java (Iskandar 1998). While L. cruentata is only known from Java, L. borbonica is widely distributed throughout Java, Sumatra, Borneo and the Thai-Malay Peninsula (van Kampen 1923; Taylor 1962; Inger 1966; Berry 1975; Manthey & Grossmann 1997; Iskandar 1998; Inger & Iskandar 2005). Information on the taxonomic status of both L. cruentata and L. borbonica is very limited. Frog species thought to be widely distributed, like L. borbonica, sometime contain several taxa, as has been demonstrated in other frog species in Sundaland, including Leptobrachium hasseltii Tschudi (Brown et al. 2009; Matsui et al. 2010; Hamidy & Matsui 2017); L. montanum Fischer; L. abbotii (Cochran) (Hamidy et al. 2011), L. nigrops Berry and Hendrickson (Hamidy et al. 2012); Limnonectes kuhlii (Tschudi, 1838) (McLeod et al. 2008; Matsui et al. 2016) and Chalcorana chalconota (Schlegel) (Inger et al. 2009). Although L. borbonica is not the type species of the genus Leptophryne, many phylogenetic studies have used L. borbonica to assess the phylogenetic position of the genus in the family Bufonidae (Zhang et al. 2013; Matsui et al. 2007; Matsui et al. 2012; Pyron & Wiens 2011), but none have evaluated the intraspecific level of divergence in L. borbonica. Accepted by J. Rowley: 6 Jun. 2018; published: 26 Jul. 2018 427 The common name of Leptophryne cruentata is the bleeding toad, referring to the distinct red pattern on its dorsum. The species is listed as Critically Endangered on the IUCN Red List of Threatened Species because of its small known range and declining population numbers (Iskandar & Mumpuni 2004). Leptophryne cruentata was formerly known only from Mt. Gede and its surrounds (Liem 1971; Iskandar 1998) and Mt. Halimun (Kurniati 2003; Kurniati 2006), but this species has recently been reported from Mt. Ciremai, about 160 km east of Mt. Gede (Setiawan et al. 2014), and Mt. Slamet, about 250 km east of Mt. Gede as the easternmost record of this species (Mumpuni 2014). We examined molecular and morphological characters of the populations from Mt. Slamet and Mt. Ciremai and compared these with the type series and newly collected topotypic material of L. cruentata. On the basis of molecular and morphological differences between the Mt. Slamet-Mt. Ciremai populations and topotypic population, we herein describe the populations from Mt. Slamet and Mt. Ciremai as a new species. Materials and methods We examined specimens of L. cruentata and L. borbonica stored in the Museum Zoologicum Bogoriense (MZB), Research Center for Biology, Indonesian Institute of Sciences (LIPI), and in The Wildlife Ecology Laboratory, Conservation of Natural Resources and Ecotourism Department, Forestry Faculty of Bogor Agricultural University (MDK_IPB) (Table 1 and Appendix). For comparison, we also examined the type series of Letophryne cruentata (syntypes RMNH 2130) and Leptophryne borbonica (syntypes RMNH 1739) stored in the Naturalist Biodiversity Center (formerly the Rijksmuseum van Natuurlijke Historie, RMNH). We analyzed 473 base pairs (bp) of mitochondrial 16S rRNA from ten adult specimens of Leptophryne spp. (Table 1). DNA was extracted using the standard Phenol-Chloroform extraction procedure (Sambrook et al. 1989). We used the primers: L2606 5’−CTGACCGTGCAAAGGTAGCGTAATCACT−3’ H3056 and 5’ CTCCGGTCTGAACTCAGATCACGTAGG−3’ (Hedges et al. 1993) to amplify a section of the 16S rRNA gene. We followed Matsui et al. (2010) for PCR procedures. The purified PCR products were sequenced directly by 1st Base Asia (Singapore). We validated sequence data using Chromas pro software (Technelysium Pty Ltd., Tewntin, Australia) and aligned with published data from GenBank (Table 1) using Clustal W in MEGA 6.06 (Tamura et al. 2013). We used four representative bufonid species as outgroups: Ingerophrynus parvus (Boulenger); Ansonia penangensis Stoliczka; Pelophryne signata (Boulenger), and Sabahphrynus maculatus (Mocquard). For phylogenetic analyses, we performed Bayesian (BI), Maximum Likelihood (ML) and Neighbor Joining (NJ) analyses. We used the Akaike criterion as implemented in Kakusan 3 (Tanabe 2007) to select the best model of evolution for BI and ML analyses. A general time-reversible (GTR) with gamma shape parameter (G) was selected as the best-fitting model. We estimated BI analysis using MrBayes 3.1.2 (Ronquist and Huelsenbeck 2003) for 20 million generations with parameters and topology sampling every 1000 generations, Markov chain Monte Carlo (MCMC) diagnosis frequency of 100000. We discarded 25% of the first analysis as burn-in. We ran ML analysis using RAxML version 8.2.9 (Stamatakis 2014) using the CIPRES Science Gateway platform (Miller et al.2010), and with 1000 bootstrap replicates. We conducted NJ analysis using MEGA6.06 (Tamura et al. 2013) with 1000 bootstrap replications to derive branch support. We estimated the genetic distance (uncorrected p-distance) using MEGA6.06 (Tamura et al. 2013) We examined 26 morphological characters, mainly following Matsui (1984), measuring to the nearest 0.1 mm with a digital calipers the following: 1) snout-vent length (SVL), tip of snout to vent; 2) head length (HL), posterior margin of lower jaw to tip of snout; 3) head width (HW), widest distance of the head, measured at the commissure of the jaws; 4) snout length (SL), from anterior angle of the eye to the tip of snout along the canthus rostralis; 5) snout-nostril length (SNL), from the anterior edge of the nostril to the tip of snout; 6) nostril-eye length (NEL), from the posterior edge of nostril to the anterior edge of eye; 7) internarial distance (IND), shortest distance between the nostrils; 8) interorbital distance (IOD), shortest distance across the top of the head between the medial margins of the orbits; 9) upper eyelid width (UEW), from the base of the upper eyelid to the tip of eyelid; 10) eye diameter (ED), horizontal distance between the anterior and posterior corners of the eye; 11) tympanum diameter (TD), widest horizontal width of tympanum; 12) brachium length (BL), length of flexed elbow, from the axilla to the joint between the elbow and forearm; 13) lower arm length (LAL), from elbow to the tip of fourth finger; 14) hand length (HAL), from the base of the inner palmar tubercle to the tip of fourth finger; 15) first finger length 428 · Zootaxa 4450 (4) © 2018 Magnolia Press HAMIDY ET AL. (fin1L); 16) third finger length (fin3L) finger length, measured from the base of the first articular tubercle to the tip of the finger; 17) hindlimb length (HLL), from the vent to tip of fourth toe; 18) tibia length (TBL), from the outer surface of the flexed knee to the tibio-tarsal joint; 19) tarsus length (TSL), from tibio-tarsal joint to the base of the inner metatarsal tubercle; 20) foot length (FL), from the inner metatarsal tubercle to the tip of fourth toe; 21) first toe length (Toe1L); 22) fourth toe length (Toe4L); 23) fifth toe length (Toe5L), toe length measured from the base of first subarticular tubercle to tip of each toe; 24) outer palmar tubercle length (OPTL), from the anterior to the posterior edge of the outer palmar tubercle; 25) outer metatarsal tubercle length (OMTL), the longest length of outer metatarsal; 26) inner metatarsal tubercle length (IMTL), the longest length of inner metatarsal tubercle. We followed Glaw and Vences (1994) to describe the webbing formula. Advertisement calls were recorded from Curug (waterfall) Cisurian, Mt. Ciremai on 10 March 2017 2338 h using an Olympus LS-11 sound recorder with its built-in microphones in stereo sound mode (sampling frequency 44.1 kHz and 16 bit rate). Calls were recorded at an air temperature of 22.7 °C and a relative humidity of 82.3%. We recorded the calls at a distance proximately 0.1–0.3 m and measured the air temperature and air humidity using REED LM-8000 (thermometer and hygrometer). For visualization, we followed Kurniati (2016), we first converted the stereo sound to mono sound and then converted the calls to 48 kHz and 16 bits using Adobe Audition version 3.0. (Adobe Systems Incorporated, California, USA). We analyzed four advertisement calls from a single individual (MZB Amph 28566) using Raven Pro version 1.4 for Windows (Cornell Laboratory of Ornithology, Ithaca, New York, U.S.A.). We followed Pettitt et al. (2002) in defining a call and a pulse. For each of call, we measured the following parameters: call duration (s; the duration of a single call, measured from the beginning to the end of a call), call interval (s; the interval between two consecutive calls, measured from the end of the call to the beginning of consecutive call); call period (s; call duration plus call interval, or time between the beginning of one call to the beginning of the consecutive call), the number of pulses per call, pulse duration (ms; the duration of a single pulse, measured from the beginning to the end of a pulse), pulse interval (ms; the interval between two consecutive pulses, measured from the end of the pulse to the beginning of consecutive pulse), pulse period (ms; pulse duration plus pulse interval, or time between the beginning of one pulse to the beginning of the consecutive pulse), pulse rate (pulses/s; number of pulses repeated within a defined time period within a call), and dominant frequency (kHz). Temporal and frequency information were measured from the audio spectrograms with fastFourier transform (FFT) of 512 points, 50% overlap with Hanning window. Results We obtained 473 bp of mitochondrial 16S rRNA gene, within which 159 sites were variable and 116 were parsimoniously informative. The likelihood values (-ln Ls) of the ML and BI were 1950.6 and 1952.2, respectively. All analyses resulted in essentially the same topologies. They differed only in support values for a monophyletic group of Leptophryne that was supported by two analyses (BPP=1, MLBP=96), but not supported in the NJ analysis, and for a monophyletic group of L. borbonica that was supported by two analyses (MLBP=70, NJBP=98), but not supported in the BI analysis. The population of Mt. Slamet and Mt. Ciremai were recovered deeply nested in the L. cruentata group (BPP=1, MLBP=100, NJBP=100). The Leptophryne cruentata group contained two distinct lineages: 1) an unnamed lineage from Mt. Slamet and M. Ciremai (MLBP=100, BPP=1, NJBP=100) and 2) true L. cruentata from west Java (MLBP=100, BPP=1, NJBP=100). The Leptophryne borbonica group was divided into two distinct clades: 1) Clade I containing L. borbonica from west Java and a lineage from Bengkulu, Sumatra (Sumatra I) (BPP=1, MLBP=97, NJBP=99) and 2) Clade II containing lineages from northern Borneo and Lampung (Sumatra II) (BPP=1, MLBP=95, NJBP=98). The genetic distance (uncorrected p-distance) between Leptophryne cruentata and Leptophryne borbonica at the gene fragment examined is high (range = 12.4–14.6%) (Table 2). The two distinct lineages within L. cruentata have a genetic distance of 5.1–5.6% (Table 2), and the genetic distance among lineages of L. borbonica ranges from 4.2–4.9% (Borneo vs Sumatra II) to 8.5–9.6% (Java vs Borneo). The two Sumatran populations of L. borbonica (Sumatra I vs Sumatra II) have a genetic distance 6.2% (Table 2). These genetic distances are high, exceeding that observed between distinct species of frog at the 16S rRNA gene fragment examined (e.g. Fouquet et al. 2007, Vences et al. 2005). The genetic distances within unnamed lineage are 0.0–0.9% (Table 2). NEW LEPTOPHRYNE JAVA Zootaxa 4450 (4) © 2018 Magnolia Press · 429 430 · Zootaxa 4450 (4) © 2018 Magnolia Press TABLE 1. Samples used for mtDNA analysis in this study, together with species identification, specimen voucher number, locality, GenBank accession numbers, and references. MZB: Museum Zoologicum Bogoriense; MDKIPB: Wildlife Laboratory, Conservation of Natural Resources and Ecotourism Department, Forestry Faculty of Bogor Agricultural University; MVZ: Museum of Vertebrate Zoology, University of California Berkeley; KUHE: Human and Environment Studies, Kyoto University; BOR: University of Malaysia, Sabah; VUB: VUB, Vrije Universiteit Brussel; SP: Sabah Park; UTA: Amphibian and Reptile Diversity Center, Department Biology University of Texas at Arlington. HAMIDY ET AL. Species Specimen Voucher Locality GenBankNumber Source Leptophryne javanica sp. nov. MZB Amph 15941 Indonesia, Java, central Java, Tegal, Bumi Jawa, Guci, Mount Slamet KY907468 This study Leptophryne javanica sp. nov. MZB Amph 15942 Indonesia, Java, central Java, Tegal, Bumi Jawa, Guci, Mount Slamet KY907469 This study Leptophryne javanica sp. nov. MZB Amph 15943 Indonesia, Java, central Java, Tegal, Bumi Jawa, Guci, Mount Slamet KY907470 This study Leptophryne javanica sp. nov. MZB Amph 15946 Indonesia, Java, central Java, Tegal, Bumi Jawa, Guci, Mount Slamet KY907471 This study Leptophryne javanica sp. nov. MZB Amph 28564 Indonesia, Java, Kuningan, Jalaksana, Sukamukti, Mount Ciremai KY907472 This study Leptophryne javanica sp. nov. MZB Amph 28566 Indonesia, Java, Kuningan, Jalaksana, Sukamukti, Mount Ciremai KY907473 This study Leptophrune cruentata MZB Amph 22257 Indonesia, Java, west Java, Cianjur, Cibodas, Cibereum, Mount Gede KY907476 This study Leptophryne cruentata MZB Amph 22258 Indonesia, Java, west Java, Cianjur, Cibodas, Cibereum, Mount Gede KY907477 This study Leptophryne cruentata UTA A 62522 Indonesia, Java, west Java, Cianjur, Cibodas, Cibereum, Mount Gede KY907476 Smart et al. (2017) Leptophryne borbonica MDKIPB TNGP 3 Indonesia, Java, west Java, Sukabumi, Lido, Bodogol KY907474 This study Leptophryne borbonica MDKIPB TNGP 7 Indonesia, Java, west Java, Sukabumi, Lido, Bodogol KY907475 This study Leptophryne borbonica MVZ Herp 239142 Indonesia, Sumatra, Bengkulu, Kepahiang, Taba Penanjung JX564876 Zhang et al. (2013) Leptophryne borbonica KUHE 53887 Malaysia, Borneo, Sarawak, Penrissen AB746458 Matsui et al. (2012) Leptophryne borbonica BOR 08127 Malaysia, Borneo, Sabah, Crocker Range, Ulu Kimanis AB331716 Matsui et al. (2007) Leptophryne borbonica VUB 0673 Malaysia, Borneo EF107164 Roelants et al. (2007) Leptophryne borbonica UTA A 62486 Indonesia, Sumatra, Lampung, Tanggamus, Ngarip KX192095 Smart et al. (2017) Ansonia penangensis KUHE UNL1 Malaysia, Peninsular Malaysia, Penang island AB435262 Matsui et al. (2010) Ingerophrynus parvus KUHE 39047 Malaysia, Peninsular Malaysia, Penang island AB746455 Matsui et al. (2012) Pelophryne signata KUHE 53200 Malaysia, Borneo, Sarawak, Kuching AB746456 Matsui et al. (2012) Sabahphrynus maculatus SP 26033 Malaysia, Borneo, Sabah, Mount Kinabalu, Kiau AB331708 Matsui et al. (2007) TABLE 2. Uncorrected 16S rRNA pairwise distances (%) among Leptophryne and other representative bufonids. No Species 1 2 3 4 5 6 7 8 9 10 1 Lepotphryne javanica sp. nov. 0.0–0.9 2 Leptophryne cruentata 5.1–5.6 3 Leptophryne borbonica (Java) 13.9–14.6 14.3 0.0 4 Leptophryne borbonica (Sumatra I) 13.5–13.7 13.1 4.5 5 Leptophryne borbonica (Borneo) 6 Leptophryne borbonica (Sumatra II) 13.5–14.1 13.5 8.9 6.2 4.2–4.9 7 Ingerophrynus parvus 16.5–16.7 16.7 15.5 14.2 15.0–15.3 15.5 – 8 Pelophryne signata 17.5–17.9 16.2 14.2 12.4 12.9–13.3 12.6 11.3 – 9 Ansonia penangensis 18.5–18.8 16.8 15.5 13.5 12.9–13.5 14.2 14.1 11.5 – 10 Sabahphrynus maculatus 14.2–14.9 13.1 12.0 11.5 10.9–11.5 10.9 13.0 11.4 13.0 – 0.0 – 12.8–14.5 12.4–13.0 8.5–9.6 7.0–7.6 0.8–1.5 – FIGURE 1. Map of Java island, showing known localities of Leptophryne javanica sp. nov. (stars, 1=Mt. Slamet, 2=Mt. Ciremai) and Leptophryne cruentata (diamonds, 3=Mt. Gede-Pangrango, 4=Mt. Halimun-Salak). Systematics Leptophryne javanica new species (Figs. 3 A, 4, 5, 6 A, 7 A) Leptophryne cruentata (Tschudi, 1838): Mumpuni 2014 Holotype: an adult male MZB Amph 15946 (Figs. 3A & 4) (SVL 23.2 mm), collected by Mumpuni and Mulyadi on October 2009 2000 h from the north-western slope of Mt. Slamet, Curug [water fall] Awu, Desa [village] Guci, NEW LEPTOPHRYNE JAVA Zootaxa 4450 (4) © 2018 Magnolia Press · 431 Kecamatan [sub district] Bumi Jawa, Kabupaten [regency] Tegal, Provinsi [Province] Jawa Tengah (S 7°11'57.51", E 109°10'4.94", elevation 1400 m a.s.l.) (Fig. 1). Paratypes: Three adult males, MZB Amph 15941 (SVL 23.3 mm), MZB Amph 15942 (SVL 22.5 mm), and MZB Amph 15943 (SVL 23.9 mm, Fig. 6.I & 7.A) collected from same locality, time and same collectors as the holotype; two adult males MZB Amph 28565 (SVL 24.0 mm), MZB Amph 28566 (SVL 23.7 mm) and an adult female MZB Amph 28564 (SVL 29.6 mm, Figs. 3B & 5) collected by Farist Alhadi, Didi Saiful Mahdi, Aldio Dwi Putra and Ahmad Nabil Faturahman on 10 March 2017 at 1900 h from Curug Cisurian, Mt. Ciremai, Desa Sukamukti, Kecamatan Jalaksana, Kabupaten Kuningan, Provinsi Jawa Barat (S 06º56’14.6”, E 108º25’47.0”, elevation 1158 to 1201 m a.s.l.) (Fig. 1). FIGURE 2. Maximum Likelihood tree of ~473 bp fragment of 16S rRNA gene for Leptophryne javanica sp. nov., along with representatives all Leptophryne species. Values above and below branch indicate Bayesian Posterior Probabilities (BPP), Maximum Likelihood Bootstrap Proportion (MLBP), and Neighbour Joining Bootstrap Proportion (NJBP). Referred specimens: Four adult males, MZB Amph 15940, 15944, 15945, 15947 collected from the same locality, time and same collector as the holotype. Etymology. The specific epithet is in reference to Java, the island where the type series was collected. Diagnosis. The new species is placed in the genus Leptophryne on the basis of it possessing the following characteristics: small size (<50 mm SVL); body and limbs slender; firmisternal pectoral girdle present; tympanum visible; distinct paratoid gland present; tip of the fingers and toes rounded (not dilated); hands with basal webbing between fingers; fourth toe not broadly webbed; and large, elongate tubercle near base of each toe (Davis 1935; Inger 1996; Malkmus et al. 2002). Moreover, the new species is assigned to the genus Leptophryne on the basis of a well-supported phylogenetic hypothesis based upon 473 bp of the mitochondrial 16S rRNA gene (Fig. 2). The new species differs from its congeners in having a small body size (adult males 22.2–24.0 mm and single adult female 29.6 mm in SVL; Table 3), moderately slender body, dark grey dorsum mottled with distinct yellow, tip of the fingers and toes blunt, hindlimbs short, forth toe short; basal webbing on the hands, well developed webbing on toes; snout very protruding, pupils horizontal, parotoid gland present, tympanum indistinct and vomerine teeth absent; adult males with a median subgular vocal sac, enlarged arm, and nuptial pad. 432 · Zootaxa 4450 (4) © 2018 Magnolia Press HAMIDY ET AL. Description of holotype (measurements in mm). Small size (SVL 23.2); habitus moderately slender; head slightly longer (HL 7.6) than broad (HW 7.1), without bony crest; snout obtusely pointed, protruding in profile, projecting beyond lower jaw, longer (SL 2.9) than upper eyelid (UEW 2.0); canthus rostralis angular, loreal region vertical, concave; nostril nearer the tip of snout (SNL 0.9) than to the eye (NEL 2.0), latter much shorter than eye diameter (ED 3.0); interorbital space (IOD 2.9) much broader than the upper eyelid (UEW 2.0); tympanum indistinct, small (TD 0.8); no vomerine teeth; a median subgular vocal sac present; tongue mushroom-shaped, without papillae, notched posteriorly. Brachium length (BL 5.1) shorter than hand length (HAL 6.9), and much shorter than lower arm length (LAL 12.6); lower arm enlarged, much wider than brachium. Hands with basal webbing, fingers moderately slender, first finger (fin1L 1.5) shorter than second, which is shorter than fourth, the third finger is much longer (fin3L 3.9) (fin1L<fin2L<fin4L<fin3L), fingertip blunt, slightly swollen; inner palmar tubercle absent; outer palmar tubercle large (OPTL 0.9); supernumerary tubercle prominent, located near base of each finger; subarticular tubercle distinct; a distinct nuptial pad at the base of the first finger. Hindlimb slender (HLL 39.5); heels meeting when legs held at right angles body; tibia (TBL 11.9) longer than foot length (FL 10.4); tarsus (TSL 5.9) longer than fourth toe length (Toe4L 5.7); first toe (Toe1L 1.1)<second toe<third toe<fifth toe (Toe5L 3.4)<fourth toe (Toe4L 5.7), tibio-tarsal articulation of adpressed limb reaching to the nostril, toe tips blunt and slightly swollen, toe webs rather well developed, webbing not fleshy, formula I 0˗1 II 0˗1½ III 0˗2 IV 2˗½ V. Inner metatarsal tubercle distinct (IMTL 1.2) more than twice size of outer metatarsal tubercle (OMTL 0.5); large supernumerary tubercle located near the base of each toe; subarticular tubercle distinct; tarsal fold present. FIGURE 3. Photos in life of (A) male holotype (MZB Amph 15946) and (B) Female paratype (MZB 28564) of Leptophryne javanica sp. nov., (C) male (MZB Amph 22257) (photographs by Farist Alhadi), and (D) female (uncatalogued) (photographs by Arief Tajali), of Leptophryne cruentata from Cibereum waterfall, Mt. Gede. NEW LEPTOPHRYNE JAVA Zootaxa 4450 (4) © 2018 Magnolia Press · 433 FIGURE 4. Dorsal and ventral views of preserved male holotype Leptophryne javanica sp. nov. (MZB Amph 15946) (Above). Lateral view of head, ventral surfaces of left foot and right hand, and dorsal surface of right hand of the male holotype (MZB Amph 15946) (Below). Scale bars = 5 mm. Skin above with small granular tubercles, scattered on all parts, including the dorsal surface of the limbs; mandibular spines present ; paratoid glands distinct, consisting of a pair of oval glands in a line, continuous with an oblique row of conspicuously enlarged warts along the dorsolateral surface (Fig. 7); supratympanic fold absent; ventrum weakly granulated, particularly on chest; nuptial pads present; pectoral glands, femoral glands, dermal ridges on the limbs, and pineal spot are absent. Colour. In life, dorsally and laterally dark grey with distinct mottled yellow on head, back and limbs; groin and ventral surface of limbs, tibia, foot, hand, and webbing reddish; belly with a suffusion of yellow, chest and throat reddish; limbs with distinct yellow bars dorsally; posterior surface of thigh with yellow bars, barring continuing to the posterior surfaces of the flank; upper lip with yellow bars, loreal region dark grey with small yellow spots; pupil horizontal; iris golden with reticulated black pattern. In preservative, some yellow patterning fades to white, while the dark grey coloration on the dorsum darkens. Variations. Morphometric variation is shown in Table 3. Male body size ranges from 22.2 mm to 24.0 mm. The male paratype MZB Amph 15943 is the largest and male paratype MZB Amph 15940 is the smallest in the type series. Four type specimens (MZB Amph 15942, 15943, 15946, 15947) have distinct black nuptial pads on the basal of the first finger while other type specimens (MZB Amph 15940, 15941, 15945, 15944) have brown nuptial pads. The tibio-tarsal articulation of adpressed hindlimbs reaches to the nostril in all but two type specimens (MZB Amph 15944, 15945), where it reaches the snout. The female paratype (MZB Amph 28564) has a much larger body size (SVL 29.6 mm) compared to males. The irregular black spots and hour glass marking are present on the dorsum of the female paratype but absent in all male specimens. 434 · Zootaxa 4450 (4) © 2018 Magnolia Press HAMIDY ET AL. NEW LEPTOPHRYNE JAVA TABLE 3. Morphological measurements (mm) of Javanese Leptophryne species. Abbreviations defined in text. Characters Leptophryne javanica sp. nov. Leptophryne cruentata Leptophryne barbonica (Java) Zootaxa 4450 (4) © 2018 Magnolia Press · Holotype Males (n = 10) Female (n=1) Males (n = 12) Females (n = 12) Males (n = 12) Mean±SD Range Range Mean±SD Range Mean±SD Range Mean±SD Range 23.0±0.68 22.2–24.0 MZB Amph 28564 29.6 Mean±SD SVL MZB Amph 15946 23.2 Females (n = 13) 25.1±1.03 23.3–26.7 34.4±2.06 31.1–37.4 23.8±1.18 21.7–25.8 30.3±2.13 26.1–33.3 HL 7.6 7.5±0.18 7.3–7.7 8.7 8.1±0.34 7.7–8.9 10.2±0.62 9.1–11.1 7.6±0.25 7.1–8.0 8.4±0.53 7.5–9.1 HW 7.1 7.0±0.27 6.7–7.6 8.3 7.3±0.39 6.8–8.2 9.2±0.68 8.0–10.0 6.8±0.34 6.4–7.5 7.5±0.47 6.7–8.3 SL 2.9 3.0±0.21 2.6–3.3 3.2 3.2±0.13 3.0–3.5 3.9±0.37 3.3–4.5 2.9±0.17 2.7–3.4 3.3±0.36 2.8–4.0 SNL 0.9 0.9±0.23 0.6–1.4 1.5 1.1±0.20 0.8–1.6 1.5±0.86 1.1–4.2 0.8±0.15 0.5–1.1 0.8±0.11 0.7–1.0 NEL 2.0 1.8±0.21 1.5–2.1 1.8 2.0±0.17 1.8–2.3 2.4±0.61 1.1–3.2 1.9±0.26 1.5–2.5 2.1±0.33 1.3–2.5 IND 2.1 3.4±0.26 3.1–3.8 2.6 1.9±0.19 1.6–2.3 2.3±0.27 1.9–2.7 1.7±0.17 1.5–2.1 1.8±0.18 1.5–2.2 IOD 2.9 2.9±0.30 2.3–3.2 4.2 3.0±0.26 2.5–3.5 3.7±0.76 3.1–5.9 2.5±0.27 2.1–2.9 3.1±0.34 2.3–3.8 UEW 2.0 2.1±0.16 1.8–2.3 2.8 2.2±0.18 1.9–2.6 2.8±0.20 2.5–3.2 2.5±0.23 2.2–3.0 3.0±0.18 2.6–3.2 ED 3.0 2.9±0.19 2.5–3.2 3.4 3.0±0.23 2.7–3.3 3.7±0.28 3.3–4.1 3.3±0.22 3.0–3.8 3.8±0.34 3.2–4.1 TD 0.8 0.7±0.17 0.4–0.9 0.9 0.7±0.19 0.4–1.0 0.9±0.13 0.7–1.1 1.2±0.15 0.8–1.3 1.4±0.18 1.2–1.8 BL 5.1 5.7±0.47 4.7–6.2 7.4 5.3±0.42 4.5–6.0 6.6±0.34 6.2–7.2 5.7±0.40 4.8–6.3 7.8±0.78 6.5–8.9 LAL 12.6 12.5±0.28 12.1–13.0 16.3 12.9±0.58 12.2–14.2 17.5±1.18 15.5–19.5 13.6±0.38 12.9–14.1 17.3±0.88 15.7–18.8 HAL 6.9 6.8±0.19 6.5–7.2 9.2 7.1±0.32 6.7–7.6 9.5±0.73 8.1–10.5 7.6±0.35 6.9–8.1 9.1±0.51 8.2–9.7 OPTL 0.9 1.1±0.15 0.8–1.3 1.3 1.2±0.18 0.9–1.5 1.5±0.33 1.1–2.3 1.2±0.28 0.4–1.4 1.4±0.26 1.0–2.0 fin1L 1.5 1.3±0.13 1.1–1.6 2.1 1.4±0.20 1.1–1.7 2.2±0.43 1.0–2.7 2.0±0.24 1.7–2.5 2.7±0.21 2.2–3.0 fin3L 3.9 3.8±0.31 3.4–4.3 5.5 3.9±0.28 3.5–4.4 5.4±0.62 4.5–6.7 4.3±0.33 3.8–5.1 5.4±0.35 4.8–6.3 HLL 39.5 39.3±1.22 37.0–40.9 50.1 40.9±2.13 37.9–45.6 52.9±2.9 47.2–56.8 45±1.37 43.0–47.0 57.3±2.23 54.3–62.2 TBL 11.9 12.0±0.23 11.7–12.5 15.6 12.4±0.52 11.7–13.8 16±0.62 15.2–17.0 14.1±0.46 13.4–14.9 18.3±0.73 17.5–19.6 TSL 5.9 6.0±0.30 5.6–6.6 7.6 6.4±0.31 5.9–6.8 8.3±0.53 7.7–9.6 6.9±0.38 6.3–7.5 8.4±0.46 7.6–9.3 FL 10.4 10.3±0.54 9.1–11.0 13.9 10.9±0.63 10.1–12.0 14.7±1.29 12.2–17.3 12.0±1.90 10.5–17.7 14.5±0.72 13.4–16.0 OMTL 0.5 0.7±0.11 0.5–0.8 0.9 0.8±0.15 0.6–1.0 1.0±0.12 0.8–1.2 0.9±0.13 0.7–1.2 1.0±0.18 0.7–1.2 IMTL 1.2 1.3±0.20 0.9–1.5 1.6 1.3±0.25 0.8–1.6 1.7±0.27 1.2–2.2 1.2±0.14 1.0–1.5 1.2±0.20 0.9–1.5 Toe1L 1.1 1.2±0.22 0.9–1.6 1.6 1.3±0.13 1.1–1.5 1.9±0.34 1.4–2.6 1.5±0.17 1.2–1.8 2.0±0.42 1.3–2.5 Toe4L 5.7 5.5±0.54 4.3–6.0 7.2 5.7±0.38 5.2–6.5 7.8±0.92 5.5–9.3 6.0±0.30 5.6–6.6 7.7±0.46 7.0–8.3 Toe5L 3.4 3.3±0.27 2.7–3.6 4.9 3.5±0.33 2.7–4.0 5.1±0.53 4.4–6.0 3.9±0.28 3.6–4.6 5.0±0.42 4.5–6.1 435 Comparisons. Morphologically and genetically, L. javanica sp. nov. is most similar to L. cruentata. It can be distinguished from L. cruentata by the following characteristics: smaller body size, SVL 22.2–24.0/n=11 (versus 23.3–26.7/n=12) in males, SVL 29.6 n=1 (versus 31.1–37.4/n=12) in females (Table 3); shorter hindlimbs, HLL 37.0–40.9/n=11 (versus 37.9–45.6/n=12) in males, HLL 50.1/n=1 (versus 47.2–56.8/n=12) in females (Table 3); shorter fourth toe length, Toe4L 4.3–6.0/n=11 (versus 5.2–6.5/n=12) in males, but longer fourth toe length, Toe4L 7.2/n=1 (versus 5.2–6.5/n=12) in females (Table 3); more extensive toe webbing, I 0˗1 II 0˗1½ III 0˗2 IV 2˗½ V (versus I ½ ˗1 II ½˗1½ III ½˗2 IV 3˗1 V) (Fig. 6C); hand with basal webbing (versus no webbing) (Fig. 6D); dorsum mottled with distinct yellow (Figs. 3A, 3B) [versus dorsum mottled with red (Fig. 3C) or combination of red and yellow (Fig. 3D)]; and very protruding snout (versus less protruding snout) (Figs. 7A, 7B). The new species can be distinguished from L. borbonica by possessing the following combination of characteristics: dark grey or black dorsum mottled with distinct yellow (Figs. 3A, 3B) (versus brown with black spots); more extensive toe webbing, I 0˗1 II 0˗1½ III 0˗2 IV 2˗½ V (versus I ½ ˗1 II 1˗2 III 1½˗3 IV 3˗1 V) (Fig. 6C); hand with basal webbing (versus no webbing) (Fig. 6D); shorter hindlimbs, HLL 37.0–40.9/n=11 (versus 43.0–47.0/n=12) (Table 3); shorter fourth toe length, Toe4L 4.3–6.0/n=11 (versus 5.6–6.6/n=12) (Table 3); tympanum indistinct (versus distinct) (Figs. 7A, 7C). FIGURE 5. Dorsal body, ventral hand, ventral foot and ventral body of a female paratype Leptophryne javanica sp. nov. (MZB Amph 28564). Scale bars = 5 mm. Photos by Farist Alhadi. Characteristics of male advertisement call. Call duration from 1.84–3.41 s (mean±SD=2.81±0.59, n=4), call interval of 48–82.94 s (mean±SD=62.83±14.71, n=4), call period of 51.11–84.78 s (mean±SD=65.43±14.20, n=4). The call contains a pulse and a continuous pure tone, which are divided into three types: single pulse repeated (type I), double pulses repeated (type II), and continuous pure tone (type III) (Fig. 8). The calls are ascending, mostly beginning with a long type I, followed by type II and type III, ended by short type I (Fig. 8). Type I contains15–18 pulses, pulse durations of 4.0–45.0 ms (mean±SD=26.08±9.47, n=4/1 male), pulse interval of 31.0– 1.38.0 ms (mean±SD=84.27±22.25, n=4/1 male), pulse periods of 51.0–169.0 ms (mean±SD=109.25±27.14, n=4/1 male), 436 · Zootaxa 4450 (4) © 2018 Magnolia Press HAMIDY ET AL. pulse rate of 5.9–19.6 (mean±SD=9.86±3.03, n=4/1 male), dominant frequency of 3.56–4.13 kHz (mean±SD=3.88±0.14, n=4/1 male). Type II contains 2–6 repeated double pulses, pulse durations of 8.0–28.0 ms (mean±SD=17.89±4.68, n=3/1 male), pulse rate of 6.9–7.9 (mean±SD=7.32±0.30, n=3/1 male), dominant frequency of 3.75–3.94 kHz (mean±SD=3.78±0.07, n=3/1 male). Type III contains 35–80 pulses (mean±SD=52.0±21.6, n=4/1 male), pulse durations of 144.0–417.0 ms (mean±SD=335.00±129.42, n=4/1 male), dominant frequency of 3.75–4.50 kHz (mean±SD=4.13±0.0.34, n=4/1 male). Range. Leptophryne javanica sp. nov. is currently known only from the northwestern slope of Mt. Slamet and Mt. Ciremai (Fig. 1). Since L. cruentata is endemic to mountains in the west of Java, Leptophryne javanica sp. nov. is likely endemic to mountains in the central part of the island with an elevation of 1,200–1,500 m a.s.l. Natural history. Eggs and larvae are unknown. The type series was collected from a swift, rocky stream with waterfalls in secondary montane forest. In Mt. Ciremai, the streams are 1.5–2.0 m in width and 0.4–0.6 m in depth. Specimens were found on rocks within the stream and on the stream banks, 0.3–0.5 m from the water (Fig. 9). Other species found in the same habitat as L. javanica sp. nov. are Limnonectes kuhlii (Tschudi), Limnonectes macrodon (Duméril and Bibron), Odorrana hosii (Boulenger), Huia masonii (Boulenger), Chalcorana chalconota (Schlegel), Phrynoides asper (Gravenhorst), Megophrys montana (Kuhl and Van Hasselt), Rhacophorus margaritifer (Schlegel), and Rhacophorus reinwardtii (Schlegel). TABLE 4. Morphometric measurements (mm) of Javanese Leptophryne species. Relative values (R) of each measurement to SVL are given in medians and its ranges. Abbreviations defined in text. Characters RHL Leptophryne javanica sp. nov. Leptophryne cruentata Leptophryne barbonica (n =10) (n = 12) (n = 12) Median Range Median Range Median Range 32.6 30.6–34.2 32.7 29.5–34.6 31.8 30.3–33.7 RHW 30.6 28.2–32.0 29.4 26.8–32.5 28.1 26.6–33.2 RSL 12.6 11.6–14.7 12.8 11.6–13.8 12.1 11.3–14.4 RSNL 4.2 2.5–6.0 4.1 3.0–6.5 3.1 2.3–4.4 RNEL 8.1 6.5–9.3 8.1 6.9–9.0 7.6 6.9–10.6 RIND 7.7 6.3–9.3 7.5 6.5–9.5 7.1 6.0–9.3 RIOD 13.0 9.7–14.2 11.8 9.9–13.8 10.5 8.2–13.0 RUEW 9.2 7.8–10.5 8.4 7.7–9.8 10.1 9.4–12.6 RED 12.6 10.6–14.0 12.1 10.6–14.1 14.1 11.5–15.2 RTD 3.1 1.6–4.0 2.9 1.6–4.1 5.1 3.6–5.8 RBL 25.1 19.7–27.3 21.4 18.7–24.2 23.9 21.1–26.1 RLAL 54.8 50.6–57.4 51.7 48.6–53.6 56.8 54.2–60.6 RHAL 29.5 27.3–30.8 27.9 26.6–30.9 31.6 27.9–34.6 ROPTL 5.0 3.5–5.6 4.6 3.6–6.1 5.3 1.5–5.8 Rfin1L 5.7 4.8–6.9 5.7 4.6–7.1 8.5 7.5–10.4 Rfin3L 16.2 14.1–19.4 15.7 14.0–17.1 17.8 16.9–19.8 RHLL 170.0 155.9–181.8 163.4 153.8–171.2 191.1 177.4–197.7 RTBL 52.3 49.4–54.9 48.9 45.9–53.1 60.0 56.0–61.8 RTSL 25.7 23.6–29.6 25.3 23.5–27.5 28.6 26.8–31.6 RFL 44.3 40.4–48.3 43.1 39.2–48.8 48.5 45.8–71.0 ROMTL 3.1 1.9–3.7 3.1 2.4–3.9 3.9 2.8–4.8 RIMTL 5.6 4.2–6.8 5.3 3.3–6.2 5.0 4.4–6.1 RToe1L 4.9 3.9–7.0 5.3 4.7–6.1 6.6 5.2–7.2 RToe4L 24.3 19.2–26.0 22.7 20.9–24.6 25.0 23.9–27.3 RToe5L 14.6 11.5–15.9 13.6 11.6–16.2 16.4 14.6–18.7 NEW LEPTOPHRYNE JAVA Zootaxa 4450 (4) © 2018 Magnolia Press · 437 FIGURE 6. Comparisons of male body: dorsum (A), ventrum (B), ventral views of right foot (C) and hand (D) of Leptophryne javanica sp. nov. (MZB Amph 15943: I), Leptophryne cruentata (MZB Amph 22257: II), and Leptophryne borbonica (MZB Amph 17126: III). Scale bars = 5 mm. 438 · Zootaxa 4450 (4) © 2018 Magnolia Press HAMIDY ET AL. FIGURE 7. Comparisons of lateral (I) and dorsal (II) views of head of (A) Leptophryne javanica sp. nov. (MZB Amph 15943), (B) Leptophryne cruentata (MZB Amph 22257), and (C) Leptophryne borbonica (MZB Amph 17126). Discussion Leptophryne javanica sp. nov. and L. cruentata are endemic to Java, occurring at relatively high elevations, from 900 to 2500 m a.s.l., while L. borbonica occurs in both lowlands and highlands (up to 1400 m a.s.l.). Leptohryne borbonica is widely distributed accross Java (Iskandar 1998) while L. cruentata is restricted to west Java and L. javanica sp. nov. likely only occurs in central Java. Both L. cruentata and L. javanica sp. nov. face a number of threats. Both species occur on volcanoes (Mt. Gede, Mt. Halimun, Mt. Slamet, and Mt. Ciremai), and although these volcanoes have remained dormant for several hundred years, both species are likely to be threatened by any future volcanic activity. The population of L. cruentata has declined significantly in the past (Iskandar 1998), but several populations appear to be recovering at several sites in west Java (Kusrini et al. 2017). Population of L. cruentata from Cibereum, Mt. Gede are reportedly infected by the amphibian chytrid fungus (Kusrini et al. 2008). Climate change is also reported to have caused a shift in the elevational distribution of L. cruentata in the last forty years (Kusrini et al. 2017). Although all populations of L. cruentata and L. javanica sp. nov. are found in conservation areas, where most forest still exists, climate change and chytrid fungus are real threats to the populations of these endemic species. Moreover, while all known populations of L. cruentata and L. javanica sp. nov. occur within National Parks, increasing human activities in these areas bring additional threats to their main habitats. Further conservation effort and surveys are needed to save these frogs from extinction. Although our molecular analysis was based upon a relatively short fragment of a single gene, our MLBS and NJBS analyses supported the genus Leptophryne to be monophyletic group, congruent the findings of Smart et al. (2017) who used both mitochondrial and nuclear genes. By examining type specimens and newly collected topotypic material we were able to elucidate for the first time the phylogenetic position of L. borbonica, L. cruentata and L. javanica sp. nov. Our results also revealed that populations of L. borbonica from Borneo and Sumatra (Sumatra I and II) form distinct molecular lineages, separated from true L. borbonica (west Java/ topotype). The two lineages from Sumatra (Sumatra I from Bengkulu and Sumatra II from Lampung) are separated NEW LEPTOPHRYNE JAVA Zootaxa 4450 (4) © 2018 Magnolia Press · 439 by 300 km, and by the Bukit Barisan Selatan mountain ranges, which may form a barrier to dispersal, as has been shown in frog species in the genus Rhacophorus (Harvey et al. 1996; Streicher et al. 2014; Hamidy & Kurniati 2015), Philautus (Wotzl et al. 2017), Chiromantis (Riyanto & Kurniati 2012), Sigalegalephrynus (Smart et al. 2017), Sumaterana (Arifin et al. 2018) and the Limnonectes kuhlii group (McLeod et al. 2011). It is likely that further undiagnosed diversity exists within the genus, and more comprehensive examination of acoustic data and detailed morphological data are likely to result in Sumatran and the Bornean populations being recognised as distinct lineages. Acknowledgements We thank Jodi Rowley and two reviewers for all comments to improve the manuscript. We are grateful to the Ministry of Research and Technology of Indonesia for grant support to Mumpuni (Program Insentif Peneliti dan Prekayasa LIPI year 2009) to conduct field collection in Mt. Slamet in October 2009, Mulyadi kindly provided logistical field support and assistance with field collection, Rini Aini for molecular laboratory assistance. We are indebted to Hellen Kurniati in helping to assist with the bioacoustics analysis. We thank Ciremai National Park for allowing MR to conduct survey under permit No: SI/40/BTNGC/SIMAKSI/201. We thank Tim van Berkel for grammar checks, Mirza D. Kusrini for allowing us to examine the specimens, Farist Alhadi, Asman A. Purwanto and Arif Tajali for providing photographs, Didi S. Mahdi, Aldio D. Putra and Ahmad N. Faturrahman for fieldwork assistances. We also thank The National Science Foundation that supported a traveling grant to RMNH through the a grant to Eric N. Smith and Michael B. Harvey (DEB−1146324), The Indonesian Institute of Sciences (LIPI) for the Indonesian Fauna Barcoding Project Grant (DIPA Puslit Biologi 2016) to Amir Hamidy. FIGURE 8. Advertisement calls of a male paratype of Leptophryne javanica sp.nov. (MZB Amph 28566). (A) Oscillograms of all four calls. Oscillograms (B) and sonograms (C) of a single call, showing variation in call type. 440 · Zootaxa 4450 (4) © 2018 Magnolia Press HAMIDY ET AL. FIGURE 9. The habitat of Leptophryne javanica sp.nov. in Mt. Ciremai. Photos by Farist Alhadi References Arifin, U., Smart, U., Hertwig, S.T., Smith, E.N., Iskandar, D.T. & Haas, A. (2018) Molecular phylogenetic analysis of a taxonomically unstable ranid from Sumatra, Indonesia, reveals a new genus with gastromyzophorous tadpoles and two NEW LEPTOPHRYNE JAVA Zootaxa 4450 (4) © 2018 Magnolia Press · 441 new species. Zoosystematics and Evolution, 94 (1), 163–193. https://doi.org/10.1655/09-037.1 Berry, P.Y. (1975) The Amphibia Fauna of Peninsular Malaysia. Tropical Press, Kuala Lumpur, x + 130 pp. Brown, R.M., Siller, C.C., Diesmos, A.C. & Alcala, A.C. (2009) Philippine frogs of the genus Leptobrachium (Anura, Megophrydae), phylogeny-based species delimitation, taxonomic review, and description of three new species. Herpetological Monographs, 23, 1, 1–44. https://doi.org/10.1655/09-037.1 Davis, D.D. (1935) A new generic and family position for Bufo borbonica. Field Museum of Natural History Publication. Zoological Series, 20, 87–92. Fitzinger, L.J.F.J. (1843) Systema Reptilium. Fasciculus Primus. Braumuülleret Seidel, Wien, 106 pp. https://doi.org/10.5962/bhl.title.4694 Frost, D.R., Grant, T., Faivovich, J., Bain, R.H., Haas, A., Haddad, C.F.B., de Sá, R.O., Channing, A., Wilkinson, M., Donnellan, S.C., Raxworthy, C.J., Campbell, J.A., Blotto, B.L., Moler, P.E., Drewes, R.C., Nussbaum, R.A., Lynch, J.D., Green, D.M. & Wheeler, W.C. (2006) The amphibian tree of life. Bulletin of the American Museum of Natural History, 297, 1–370. https://doi.org/10.1206/0003-0090 Foquet, A., Gilles, A., Vences, M., Marty, C., Blanc, M. & Gemmel, N.J. (2007) Underestimation of species richness in Neotropical frog revelaed by mtDNA analyses. PLoSone, 2, 10, 1–10. https://doi.org/10.1371/journal.pone.0001109 Hamidy, A., Matsui, M., Shimada, T., Nishikawa, K., Yambun, P., Sudin, A., Kusrini, M.D. & Kurniati, H. (2011) Morphological and genetic discordance in two species of Bornean Leptobrachium (Amphibia, Anura, Megophryidae). Molecular Phylogenetic and Evolution, 2011, 904–913. https://doi.org/10.1016/j.ympev.2011.08.020 Hamidy, A., Matsui, M., Nishikawa, K. & Belabut, D.M. (2012) Detection of cryptic taxa in Leptobrachium nigrops (Amphibia, Anura, Megophryidae) with description of two new species. Zootaxa, 3398, 22–39. Hamidy, A. & Kurniati, H. (2015) A new species of tree frog genus Rhacophorus from Sumatra, Indonesia (Amphibia, Anura). Zootaxa, 3947 (1), 049–066. https://doi.org/10.11646/zootaxa.3947.1.3 Hamidy, A. & Matsui, M. (2017) Phylogenetic relationships of Leptobrachium hasseltii Tschudi, 1838 (Amphibia, Anura, Megophryidae) - Detection of a possible cryptic species. Treubia, 44, 15–28. Available from: http://ejournal.biologi.lipi.go.id/index.php/treubia/article/view/3286/2906 (Accessed 25 Jul. 2018) Harvey, M.B., Pemberton, A.J. & Smith, E.N. (2002) New and poorly known parachuting frogs (Rhacophoridae: Rhacophorus) from Sumatra and Java. Herpetological Monographs, 16, 46–92. https://doi.org/10.1655/0733-1347(2002)016[0046:napkpf]2.0.co;2 Hedges, S.B., Nussbaum, R.A. & Maxson, L.R. (1993) Caecilian phylogeny and biogeography inferred from mitochondrial DNA sequences of the 12S rRNA and 16S rRNA genes (Amphibia, Gymnophiona). Herpetological Monographs, 7, 64– 76. https://doi.org/10.2307/1466952 Inger, R.F. (1966) The systematics and zoogeography of the Amphibia of Borneo. Fieldiana Zoology, 52, 1–402. Inger, R.F. & Iskandar, D.T. (2005) A collection of amphibians from West Sumatra, with description of new species of Megophrys (Amphibia, Anura). The Raffless Bulletin of Zoology, 53, 133–142. Inger, R.F., Stuart, B.L. & Iskandar, D.T. (2009) Systematics of a widespread Southeast Asian frog, Rana chalconota (Amphibia, Anura, Ranidae). Zoological Journal of the Linnean Society, 155, 123–147. https://doi.org/10.1111/j.1096-3642.2008.00440.x Iskandar, D.T. (1998) The Amphibians of Java and Bali. Research and Development Center for Biology, LIPI, Bogor, 117 pp. Iskandar, D.T & Mumpuni.(2004) Leptophryne cruentata. The IUCN Red List of Threatened Species 2004: e.T54815A1207443. International Union of Conservation Nation. Available from: http://iucnredlist.org/details/54815/0 (accessed 3 February 2017) https://doi.org/10.2305/IUCN.UK.2004.RLTS.T54815A11207443.en Kusrini, M.D., Skerratt, L., Berger, L., Garland, S. & Endarwin, W. (2008) Chytridiomycosis in frogs of Mount GedePangrango, Indonesia. Disease of Aquatic Organisms, 82, 187–194. https://doi.org/10.3354/dao01981 Kusrini, M.D., Lubis, M.I., Endarwin, W., Yazid, M., Darmawan, B., Ul-Hasanah, A.U., Sholihat, N., Tajali, A., Lestari, V., Utama, H., Nasir, D.M., Ardiansyah, D. & Rachmadi, R. (2017) Elevation shift range after 40 years: The amphibians of Mount Gede Pangrango National Park revisited. Conservation Biology, 206, 75–84. https://doi.org/10.1016/j.biocon.2016.12.018 Kurniati, H. (2003) Kodok merah Leptopryne cruentata ditemukan di Taman Nasional Gunung Halimun Jawa Barat. Fauna Indonesia, 5, 71–74. Kurniati, H. (2006) The amphibian species in Gunung Halimun National Park, West Java, Indonesia. Zoo Indonesia, 15, 107– 120. Kurniati, H. (2016) Bioacoustics of Hylarana celebensis (Peters, 1872) (Anura: Ranidae) From Sulawesi. Jurnal Biology 442 · Zootaxa 4450 (4) © 2018 Magnolia Press HAMIDY ET AL. Indonesia, 12, 1–7. Liem, D.S.S. (1971) The frogs and toads of Tjibodas National Park, Mount Gede, Java, Indonesia. Philippine Journal of Science, 100, 131–161. Manthey, U. & Grosmann, W. (1997) Amphibien und Repetilien Südostasiens. Natur und Tier, Verlag, 512 pp. Matsui, M. (1984) Morphometric variation analyzes and revision of the Japanese toads (Genus Bufo, Bufonidae). Contributions from the Biological Laboratory, Kyoto University, 26, 209–428. Matsui, M., Yambun, P. & Sudin, A. (2007) Taxonomic relationships of Ansonia anotis Inger, Tan, and Yambun, 2001 and Pedostibes maculatus (Mocquard, 1890), with a Description of a new genus (Amphibia, Bufonidae). Zoological Science, 24, 1159–1166. https://doi.org/10.2108/zsj.24.1159 Matsui, M., Hamidy, A., Murphy, R.W., Khonsue, W., Yambun, P., Shimada, T., Ahmad, N., Belabut, D.M. & Jiang, J-P. (2010) Phylogenetic relationship of megophyid frogs of the genus Leptobrachium (Amphibia, Anura) as revealed by mtDNA gene sequences. Molecular Phylogenetic and Evolution, 56, 259–272. https://doi.org/10.1016/j.ympev.2010.03.014 Matsui, M., Nishikawa, K., Yeo, S.T. & Eto, K. (2012) Notes on a rare Bornean Bufonid Ansonia latidisca Inger, 1966, with special reference to its phylogenetic position. Current Herpetology, 31, 87–96. https://doi.org/10.5358/hsj.31.87 Matsui, M., Kuraishi, N., Eto, K., Hamidy, A., Nishikawa, K., Shimada, T., Yambun, P., Vairappan, C.S. & Hossman, M.Y. (2016) Unusually high genetic diversity in the Bornean Limnonectes kuhlii-like fanged frogs (Anura, Dicroglossidae). Molecular Phylogenetic and Evolution, 102, 305–319. https://doi.org/10.1016/j.ympev.2016.06.009 McLeod, S.M., Horner, A.J., Husted, C., Barley, A. & Iskandar, D.T. (2011) “Same-same, but different”, an unusual new species of the Limnonectes kuhlii complex from West Sumatra (Anura, Dicroglossidae). Zootaxa, 2883 (1), 52–64. https://doi.org/10.11646/zootaxa.2883.1.4 Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) “Creating the CIPRES Science Gateway for inference of large phylogenetic trees” in Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans, LA, 14 November 2010, pp. 1–8. Matsui, M.,Tominaga, A., Liu, W., Khosue, W., Grismer, L.L., Diesmos, A.C., Das, I., Sudin, A., Yambun, P., Yong, H., Sukumaran, J. & Brown, R.M. (2010) Phylogenetic relationships of Ansonia from Southeast Asia inferred from mitochondrial DNA sequences: systematic and biogeographic implications (Anura: Bufonidae). Molecular Phylogenetic and Evolution, 54, 561–570. https://doi.org/10.1016/j.ympev.2009.08.003 Mumpuni (2014) Keragaman amfibi dan catatan baru katak di kawasan wisata Guci, Provinsi Jawa Tengah. Zoo Indonesia, 23, 13–19. Pettitt, B.A., Bourne, G.R. & Bee, M.A. (2012) Quantitative Acoustic analysis of the Vocal Repertoire of the Golden Rocket Frog (Anomaloglossus beebei). Journal Acoustical Society of America, 131 (6), 4811–4820. https://doi.org/10.1121/1.4714769 Pyron, R.A. & Wiens, J.J. (2011) A large-scale phylogeny of Amphibia including 2800 species, and revised classification of extant frogs, salamanders, and caecilians. Molecular and Phylogenetics Evolution, 61, 543–583. https://doi.org/10.1016/j.ympev.2011.06.012 Riyanto, A. & Kurniati, H. (2014) Three new species of Chiromantis Peters, 1854 (Anura: Rhacophoridae) from Indonesia. Russian Journal of Herpetology, 21, 65–73. Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3, Bayesian phylogenetic inference under mix models. Bioinformatics, 19, 1572–1574. https://doi.org/10.1093/bioinformatics/btg180 Roelants, K., Gower, D.J., Wilkinson, M., Loader, S.P., Biju, S.D., Guillaume, K., Moriau, L. & Bossuyt, F. (2007) Global patterns of diversification in the history of modern amphibians. Proceedings of the National Academy Sciences, 104 (3), 887–892. https://doi.org/10.1073/pnas.0608378104 Sambrook, J., Fritschi, E.F. & Maniatis, T. (1989) Molecular Cloning, a Laboratory Manual. Cold Sprin Harbor Laboratory Press, New York, 1120 pp. Smart, U., Sarker, G.C., Arifin, U., Harvey, M.B., Sidik, I., Hamidy, A., Kurniawan, N. & Smith, E.N. (2017) A new genus and two new species of arboreal toads from higlands of Sumatra with a phylogeny of Sundaland toad genera. Herpetologica, 73 (1), 63–75. https://doi.org/10.1655/Herpetologica-D-16-00041 Setiawan, I., Rakhman, Z., Muzakkir, A., Saputro, B.P. & Zulkarnaen, I. (2014) Kajian Biodiversitas dan Pembuatan Kebun Koleksi Anggrek di Taman Nasional Gunung Ciremai. Unpublished fieldwork report, Laporan Akhir-Pusat Informasi Lingkungan Indonesia, Bogor, 115 pp. [in Indonesian] Stamatakis, A. (2014) RAxML Version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics, 30 (9), 1312–1313. https://doi.org/10.1093/bioinformatics/btu033 NEW LEPTOPHRYNE JAVA Zootaxa 4450 (4) © 2018 Magnolia Press · 443 Streicher, J.W., Hamidy, A., Harvey, M.B., Andres, B., Shaney, K.J., Kurniawan, N. & Smith, E.N. (2014) Mitochondrial DNA reveals a new species of parachuting frog (Rhacophoridae: Rhacophorus) from Sumatra. Zootaxa, 3878 (4), 351–356. https://doi.org/10.11646/zootaxa.3878.4.2 Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6, Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 30, 2725–2729. https://doi.org/10.1093/molbev/mst197 Tanabe, A.S. (2007) Kakusan, a computer program to automate the selection of a nucleotide substitution model and the configuration of a mixed model on multilocus data. Molecular Ecology, 7, 962–964. https://doi.org/10.1111/j.1471-8286.2007.01807.x Taylor, E.H. (1962) The amphibian fauna of Thailand. The University of Kansas Science Bulletin, 42 (8), 265–599. Tschudi, J. (1838) Classification der Batrachier mit Berücksichtigung der fossilen Thiere dieser Abtheilung der Reptilien. Neuchâtel, 1–99. van Kampen, P.N. (1910) Eine neue Nectophryne-Art und andere Amphibien von Deli (Sumatra). Natuurkundig tijdschrifr voor Nederlandsch Indië, 69, 18–24. van Kampen, P.N. (1912) Javanische Amphibien gesammelt von Edw. Jacobson. Notes from The Leyden Museum, 34, 75–79. van Kampen, P.N. (1923) The Amphibia of the Indo-Australian Archipelago. E.J. Brill, Leiden, xii + 304 pp. van Bocxlaer, I., Biju, S.D., Loader, S.P. & Bossuyt, F. (2009) Toad radiation reveals into-India dispersal as a source of endemism in the Western Ghats-Sri Lanka biodiversity hotspot. BMC Evolution Biology, 9 (131), 1–10 https://doi.org/10.1186/1471-2148-9-131 Vences, M., Thomas, M., Van der Meijden, A., Chiari, Y. & Vieites, D.R. (2005) Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians. Frontiers in Zoology, 2, 1. https://doi.org/10.1186/1742-9994-2-5 Wostl, E., Riyanto, A., Hamidy, A., Kurniawan, N., Smith, E.N. & Harvey, M.B. (2017) A taxonomic revision of the Philautus (Anura: Rhacophoridae) of Sumatra with the description of four new species. Herpetological Monographs, 31 (1), 70–113. https://doi.org/10.1655/HERPMONOGRAPHS-D-16-00007 Zhang, P., Liang, D., Mao, R.L., Hillis, D.M., Wake, D.B. & Cannatella, D.C. (2013). Efficient sequencing of Anuran mtDNAs and a mitogenomic exploration of the phylogeny and evolution of frogs. Molecular Biology Evolution, 30 (8), 1899–1915. https://doi.org/10.1093/molbev/mst091 APPENDIX 1. Comparative material examined. Leptophryne cruentata: (all from Indonesia, Java, West Java, n = 191): two syntype specimens RMNH 2130; Kabupaten Bogor: Kecamatan Ciomas, Ciapus, Halimun-Salak National Park, MZB Amph 17108–17109 (male) MZB Amph 2443, 2507, 17106–17107 (female); Kecamatan Nanggung, Desa Malasari, Kampung Cikeris, Halimun-Salak National Park, approximately 1300 m a.s.l., S 6º44'13", E 106º30'07", MZB Amph 11146, 17125 (male); Kecamatan Tenjolaya, Desa Gunung Malang, Curug Luhur, Halimun-Salak National Park, 779 m, S 6° 40' 19.96", E 106° 42' 47.95", MZB Amph 17123 (male) MZB Amph 3187–17124 (female); Kabupaten Cianjur: Kecamatan Cipanas, Desa Cimacan, Curug Cibereum, Gunung Gede-Pangrango National Park, 1685 m a.s.l., S 6°45'17.11", E 106°59'7.52", MZB Amph 608–615, 617, 619–622, 624–634, 638–639, 641–653, 1260–1262, 1267–1269, 1271–1276, 1278–1280, 1282– 1288, 1290–1326, 1736–1737, 1741–1746, 1750–1767, 2147, 2462, 17080, 17111, 17113, 17117, 17120, 22257–22258, 28437 (male), MZB Amph 457, 616, 618, 623, 635–637, 640, 927–928, 1257–1259, 1263–1264, 1266, 1270, 12777, 1281, 1285, 1289, 1738–13740, 13747–1749, 2395, 2446, 17110, 17112, 17114–17116, 17118–17119, 17121–17122 (female); Kecamatan Cisarua MZB Amph 1545 (male): Kabupaten Sukabumi: Kadudampit, Selabintana resort, Gunung Gede-Pangrango National Park, 1296 m a.s.l., S 6°50'14.51", E 106°57'27.84", MZB Amph 2759 (female). Leptophryne borbonica (all from Indonesia, Java, West Java, n = 111): two syntype specimens RMNH 1739; Kabupaten Bogor: Kecamatan Nanggung: Desa Malasari: Kampung Citalahab, Halimun-Salak National Park, approximately 1035 m a.s.l., S 06°44’45.7” E 106°32’21.5”, MZB Amph 7602–7607, 7616–7619, 18056 (male), MZB Amph 4029, 7610, 7611, 7613, 7615, 18052–18055, 18057–18058 (female); Kampung Cikeris, Halimun-Salak National Park, approximately 1300 m a.s.l., S 6º44'13", E 106º30'07", MZB Amph 17126 (male); Cikaniki Research Station, Halimun-Salak National Park, 1111 m a.s.l., S 6°44'58.43", E 106°32'16.52", MZB Amph 18043–18046, 18049–18051 (male), MZB Amph 3901, 18047–18048 (female); Kecamatan Sukajaya, Desa Cisarua, Kampung Leuwi Jamang, Curug Ciberang, Halimun-Salak National Park, MZB Amph 5588–5592, 5594–5595, 5597–5603, 5606–5615, 5619, 5621– 5631, 5634, 5817–5818, 5820–5827 (male), MZB Amph 5587, 5593, 5596, 5604–5605, 5616–5618, 5620, 5632–5633, 5819 (female); Kabupaten Sukabumi: Gunung Gede-Pangrango National Park, MZB Amph 6714–6726, 6728–6730 (male); Kecamatan Cicurug, Desa Benda, Bodogol research station, Gunung Gede-Pangrango National Park, 826 m a.s.l., S 6°46'34.94", E 106°51'21.78", MDK IPB TNGP 3 & TNGP 7 (male). 444 · Zootaxa 4450 (4) © 2018 Magnolia Press HAMIDY ET AL.