This article was downloaded by: [University of California, Berkeley] On: 31 October 2012, At: 09:58 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK African Journal of Herpetology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/ther20 Untangling the complex: molecular patterns in Trachylepis variegata and T. punctulata (Reptilia: Scincidae) Daniel M. Portik a a b & Aaron M. Bauer a Department of Biology, Villanova University, Villanova, PA, USA b Museum of Vertebrate Zoology and Department of Integrative Biology, University of California, Berkeley, CA, USA Version of record first published: 02 Oct 2012. To cite this article: Daniel M. Portik & Aaron M. Bauer (2012): Untangling the complex: molecular patterns in Trachylepis variegata and T. punctulata (Reptilia: Scincidae), African Journal of Herpetology, 61:2, 128-142 To link to this article: http://dx.doi.org/10.1080/21564574.2012.721808 PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. The publisher does not give any warranty express or implied or make any representation that the contents will be complete or accurate or up to date. The accuracy of any instructions, formulae, and drug doses should be independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims, proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly in connection with or arising out of the use of this material. African Journal of Herpetology, Vol. 61, No. 2, October 2012, 128"142 Untangling the complex: molecular patterns in Trachylepis variegata and T. punctulata (Reptilia: Scincidae) Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 DANIEL M. PORTIK1,2* & AARON M. BAUER1 1 Department of Biology, Villanova University, Villanova, PA, USA; 2Museum of Vertebrate Zoology and Department of Integrative Biology, University of California, Berkeley, CA, USA Abstract.*The Mabuya [!Trachylepis] lacertiformis complex is comprised of four species with a high degree of morphological overlap and a convoluted taxonomic history. Of these four species, T. punctulata and T. variegata possess the broadest ranges, together covering much of southern Africa. These two forms were elevated to species status based on slight differences in morphology, ecological differentiation and seemingly allopatric distributions. The molecular relationships of these two species, referred to as the T. variegata complex, have not been investigated. Here, we use both mitochondrial (ND2) and nuclear (RAG-1) data to test whether T. variegata and T. punctulata form reciprocally monophyletic assemblages, supporting species recognition. While we do not find direct evidence that these two species have a sister taxon relationship, our results are likely driven by an undescribed lineage within T. punctulata or by a sampling artefact. Based on all available evidence, we conservatively support recognition of T. variegata and T. punctulata as distinct species, but recommend further investigation of relationships within T. punctulata to resolve whether additional lineages are present in this group. Key words.*Trachylepis, species complex, southern Africa, phylogenetics, skink INTRODUCTION The Mabuya [!Trachylepis] lacertiformis complex (see Broadley 1975) has long presented taxonomic and systematic difficulties. These are among the most generalised of southern African skinks and have frequently been confused both with one another and with other moderate-sized species, such as Trachylepis varia. There are four forms associated with this wide-ranging species complex, including T. chimbana (Bocage 1872), T. lacertiformis (Peters 1854), T. punctulata (Bocage 1872), and T. variegata (Peters 1869). Of these four forms, two members of the group, T. chimbana and T. lacertiformis, are relatively peripheral to the region in their distribution. T. chimbana is a rupicolous species restricted to southern Angola and the Kaokoveld, and T. lacertiformis is a rupicolous species occurring in moist savanna across southern Lake Malawi, the Tete District of Mozambique, to the Hwange District in Zimbabwe, with isolated populations present in southern Angola (Fig 1). However, the widespread forms T. variegata and T. punctulata together span *Corresponding author. Email: daniel.portik@berkeley.edu Online Supplementary Material is available for this article, which can be accessed via the online version of this journal available at www.tandf.co.uk/journals/THER ISSN 2156-4574 print/ISSN 2153-3660 online # 2012 Herpetological Association of Africa http://dx.doi.org/10.1080/21564574.2012.721808 http://www.tandfonline.com Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 AFRICAN JOURNAL OF HERPETOLOGY 61(2) 2012 129 Figure 1. A map of southern Africa depicting the known ranges of Trachylepis punctulata and Trachylepis variegata. Sampling localities for each species are depicted as triangles (T. punctulata) or circles (T. variegata). The contact zone in the Usakos area of Namibia proposed by Broadley (1975, 2000) is represented by the white circle with dashed outline. Species ranges are shaded, with T. variegata in light blue, T. punctulata in light orange and T. lacertiformis in dark green, based on Broadley (1975) and Branch (1998). most of the subcontinent, each having substantially larger geographic distributions than T. chimbana and T. lacertiformis combined (Fig 1). The nomenclatural history of these two particular names, which we refer to as the T. variegata complex, is convoluted and confused by inaccurate descriptions, incorrect type localities and forgotten names. Despite the ubiquity of these skinks, their names were not stabilised until more than a century after their initial descriptions (Broadley 1975). Broadley (1975) recognised punctulata as a subspecies of T. variegata based on the apparent existence of intergrades between the two forms and an implicit application of the Biological Species Concept (Mayr 1942). Broadley (1975) defined the area producing these intergrades as the Namib Desert National Park and the Usakos area of Namibia (Fig 1). Subsequent authors (e.g., Huey & Pianka 1977; De Waal 1978; Auerbach 1987; Jacobsen 1989; Branch 1998) retained the usage of both subspecies names until Broadley (2000) elevated T. punctulata to full species status in his review of Trachylepis occurring in south-eastern Africa. In this review, Broadley (2000) noted the previously proposed contact zone in Namibia, but he suggested that if hybridisation occurs between the two forms, it is probably limited due to T. variegata being largely rupicolous and T. punctulata being arenicolous. Additionally, although overlapping in most morphological characters, Broadley (1975, 2000) demonstrated that adults of the two forms could be distinguished by the number of keels on the dorsal scales, with T. variegata having tricarinate dorsals and T. punctulata having quinquecarinate dorsals (with some dorsals having seven keels). Based on his observations about the ecological differentiation of the two forms and differences in Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 130 PORTIK & BAUER* Untangling the Trachylepis variegata complex dorsal scalation and coloration, Broadley (2000), applying the Evolutionary Species Concept (Simpson 1951; Mayden 1997), suggested T. variegata and T. punctulata be recognised as separate species. Nonetheless, the widespread use of earlier general guides (e.g., Branch 1998) has resulted in the continued use of the subspecific designation for this taxon. While thorough morphological analyses have been performed for the four forms of the T. lacertiformis complex (Broadley 1975, 2000), no genetic data have been presented to investigate their molecular relationships. It is therefore unknown whether molecular data support the morphological species boundaries as predicted by Broadley (1975, 2000). This is especially relevant for forms exhibiting substantial geographic variation in morphology, as is the case for T. punctulata (Broadley 1975), and for wide-ranging forms, including both members of the T. variegata complex. Although samples for T. chimbana and T. lacertiformis are not available, both forms of the T. variegata complex have been sufficiently sampled to allow a molecular assessment. Here, we investigate the relationships within the T. variegata complex by collecting both morphological and molecular data for samples of T. variegata and T. punctulata. We hypothesise that the molecular data will support these two taxa as distinct species, reflected as statistically supported monophyletic lineages. We test this hypothesis by reconstructing phylogenies using both mitochondrial and nuclear data, examining allele networks and examining key morphological characters. In addition, we examine levels of genetic variation and genetic distances both between and within lineages of T. variegata and T. punctulata. MATERIALS AND METHODS Sampling We obtained 26 samples representing Trachylepis punctulata and 22 samples representing T. variegata (Supplemental Table 1). In addition, we include one representative sample each of T. sulcata, T. varia and T. wahlbergii as outgroups for phylogenetic analyses (Portik et al. 2010). Individuals of T. variegata were collected from 17 unique localities ranging from the Namibian-Angolan border to the Western Cape, whereas T. punctulata samples were collected from 12 unique localities in northern Namibia, the Northern Cape and Limpopo provinces of South Africa, and north-western Zimbabwe (Fig 1). Our sampling of T. variegata covers a majority of the known range for this species, but our sampling for T. punctulata is sparse and Table 1. A list of genes and primer sets used for this study. Primer sequence is given 5? to 3?. Gene RAG-1 ND2 Primer Source Sequence (5? to 3?) Rag1SkinkF2 Rag1SkinkR2 Rag1SkinkF370 Rag1SkinkR1200 MET F1 L4437 TRP R3 H5540 Portik et al. 2010 Portik et al. 2010 Portik et al. 2010 Portik et al. 2010 Macey et al. 1997 Macey et al. 1997 TTCAAAGTGAGATCGCTTGAAA AACATCACAGCTTGATGAATGG GCCAAGGTTTTTAAGATTGACG CCCTTCTTCTTTCTCAGCAAAA AAGCTTTCGGGCCCATACC TTTAGGGCTTTGAAGGC AFRICAN JOURNAL OF HERPETOLOGY 61(2) 2012 131 we lack sampling for large geographic regions where this species has been recorded (Fig 1). Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 Molecular data Whole genomic DNA was extracted from liver or tail samples preserved in 95"100% EtOH. DNA extraction was performed using the Qiagen DNeasyTM tissue kit (Valencia, CA, USA). PCR amplifications were performed with negative controls using forward and reverse primers obtained from published sources (Table 1). Amplification reactions for both genes were initiated at 958C for 2 min followed by 35 cycles of 958C for 35 s, 508C for 35 s, and 728C for 1 min 35 s (with extension increasing 4 s per cycle). Purifications were performed using the Agencourt AMPure PCR purification kit (Agencourt Bioscience, Beverly, MA, USA). Samples were prepared for sequencing using a combination of the BigDye† Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and CleanSeq (Agencourt Bioscience, Beverly, MA, USA). Gene products were forward and reverse sequenced using an ABI3700 Automated Sequencer. Sequences were analysed using Geneious v5.4 (Drummond et al. 2011), and aligned by eye with no ambiguities. The complete mitochondrial ND2 gene was sequenced and partial exonic sequences were obtained for RAG-1. All sequences are deposited in Genbank (Accession numbers: GU931605"931611, GU931672"931679, JX568075"568152). Molecular analyses Maximum likelihood (ML) and Bayesian analyses were conducted, and we analysed RAG-1 and ND2 separately and also performed a concatenated analysis. The Akaike Information Criterion (AIC) in ModelTest v3.7 (Posada & Crandall 1998) was used to find the most appropriate model of evolution in all partitioning strategies (Posada & Buckley 2004). Maximum likelihood analyses for each data set were performed in GARLI v2.0 (Zwickl 2006). Independent and partitioned analyses were conducted using the HKY #I substitution model for the RAG-1 data set and the GTR #G #I substitution for the ND2 data. The maximum generations were set high enough to allow the automated stopping criterion to be employed. Three runs were conducted for each data set to ensure the algorithm was not trapped at a local optimum. For each analysis, 500 nonparametric bootstrap replicates were performed (Zwickl 2006), and a 50% majority-rule consensus tree was produced. Bayesian analyses were conducted using MrBayes v3.2 (Huelsenbeck & Ronquist 2001; Ronquist & Huelsenbeck 2003). For Bayesian analysis, both the nuclear and the ND2 data sets were partitioned by codon position, as third codon positions are likely to experience higher rates of substitution (Brandley et al. 2005). Therefore, the nuclear analysis contained three partitions and the ND2 analysis contained three partitions, whereas the combined analysis contained six partitions. Two parallel runs were performed with random starting trees and allowed to run for 20 000 000 generations with sampling every 1 000 generations. Stationarity was assessed using the program Tracer v1.5 (Rambaut & Drummond 2009), and a conservative approach to burn-in time was taken and trees produced during the first 25% of the total number of generations were discarded, leaving 15 000 trees for each of Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 132 PORTIK & BAUER* Untangling the Trachylepis variegata complex two parallel runs. The resulting post-burn-in trees from the two parallel runs were combined and a 50% majority rule consensus tree was calculated from a total of 30 000 trees. Heterozygous sequences were present in the RAG-1 data set, and alleles were phased using the program fastPHASE v1.4.0 (Stephens et al. 2001; Scheet & Stephens 2006). To better visualise relationships among alleles, allele networks were constructed for RAG-1 using statistical parsimony with a 95% connection significance in the program TCS v1.21 (Clement et al. 2000). Analyses were performed using phased nuclear data, and gaps were treated as a fifth state. We were unable to obtain a parsimony network for the ND2 data, as the network failed to be resolved even at 90% connection significance. To assess levels of genetic diversity within and between recovered lineages of T. punctulata and T. variegata, we examined the mean number of within population pairwise differences (K) and the nucleotide diversity (p) using Arlequin v3.11 (Excoffier & Shneider 2005). Additionally, p-distances were estimated using Mega v5.03 (Tamura et al. 2011). Morphological data We performed morphological measurements to confirm that the samples used in our molecular analyses were consistent with the taxa referred to by Broadley (2000) as T. variegata and T. punctulata. We measured or scored several characters, including: snout-vent length (SVL), midbody scale rows, number of keels on dorsal scales, number of ear lobules, number of lamellae beneath fourth finger, number of lamellae beneath fourth toe, arrangement of prefrontals (in contact or separated), number of supraciliaries and number of pretemporals. These characters are useful for diagnosing species in the genus Trachylepis (FitzSimons 1943; Broadley 2000), although T. punctulata and T. variegata overlap in many of these measurements. The number of keels on the dorsal scales appears to be the only character that consistently distinguishes T. punctulata from T. variegata, with T. variegata having tricarinate dorsals and T. punctulata having quinquecarinate dorsals (with some dorsals having seven keels) (Branch 1998; Broadley 2000). We used this character to establish species identifications for our samples with confidence. RESULTS Molecular analyses The final alignment for ND2 yielded a total of 1 053 base pairs (bp) (265 variable ingroup sites, 225 parsimony-informative) and the final alignment of RAG-1 contained 1 149 bp (73 ingroup sites, 45 parsimony-informative). The Bayesian inference (BI) and ML analyses of the concatenated data set (ND2 and RAG-1) revealed similar tree topologies, and also produced the most resolved phylogeny (Fig 2). We therefore present the results for the concatenated analysis. The phylogeny recovered contains three major clades that are well resolved at the terminal nodes, but which lack resolution at deeper nodes. These clades include: T. variegata (Bayesian posterior probability [pp] !1.0, ML bootstrap !99%), T. punctulata from Limpopo and Zimbabwe (pp !1.0, ML bootstrap ! 91%), and T. punctulata from Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 AFRICAN JOURNAL OF HERPETOLOGY 61(2) 2012 133 Figure 2. A maximum likelihood phylogram based on the concatenated molecular data set of RAG-1 and ND2. Asterisks above branches indicate Bayesian posterior probabilities !0.95, whereas asterisks below branches indicate maximum likelihood bootstrap percentages !70%. Clades are colour coded and represented by the same coloured symbols depicted in Figure 1. The scale bar represents the number of substitutions/site. Namibia and the Northern Cape (pp ! 0.97, ML bootstrap !80%) (Fig 2). Each of these clades is supported by BI and ML methods in the independent RAG-1 and ND2 data sets. However, these analyses also fail to resolve the relationships between clades at deeper nodes (not shown). A sister relationship between T. variegata and T. punctulata is therefore not supported by the phylogenetic analyses with any permutation of the molecular data. Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 134 PORTIK & BAUER* Untangling the Trachylepis variegata complex Figure 3. A nuclear allele network based on phased allelic data for RAG-1 of both Trachylepis punctulata (triangles) and Trachylepis variegata (circles). The network was constructed using statistical parsimony with a 95% connection significance. Unique haplotypes are separated by one mutational step, and black circles along connecting lines represent additional mutational steps. Shades of haplotypes correspond to the sampling localities depicted in Figure 1. There is limited structure within some of the clades recovered. In the clade consisting of T. punctulata from Namibia and the Northern Cape, the sample from the Northern Cape (KTH 555) is consistently recovered as sister to all T. punctulata from Namibia (pp ! 0.97, ML bootstrap ! 80%). Within T. variegata, the samples from northern Namibia have a sister relationship to all other samples from southern Namibia and South Africa (pp !1.0, ML bootstrap ! 99%). The allele network for the phased RAG-1 data shows some separation between the groups recovered in the phylogenetic analyses (Fig 3). Relatively few mutational steps separate the RAG-1 haplotypes occurring within T. variegata, whereas the relationships among haplotypes of both lineages of T. punctulata are more complex. There are no nuclear haplotypes shared between the major groupings recovered in the phylogenetic analyses. Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 RAG1 Lineage T. punctulata T. variegata ND2 Group K CI p CI K CI p CI All Zimbabwe, Limpopo Namibia, Northern Cape All Northern Namibia Southern Namibia, South Africa 11.10 9.17 8.68 2.45 2.46 2.27 95.14 94.73 94.10 91.35 91.54 91.27 0.0096 0.0079 0.0075 0.0021 0.0021 0.0019 90.0049 90.0046 90.0039 90.0013 90.0015 90.0012 41.02 26.66 15.84 25.94 9.33 10.02 918.59 916.29 97.44 911.85 95.92 94.80 0.0460 0.0290 0.0178 0.0247 0.0088 0.0099 90.0233 90.0221 90.0093 90.0126 90.0070 90.0053 AFRICAN JOURNAL OF HERPETOLOGY 61(2) 2012 Table 2. The average number of within population pairwise differences (K) and nucleotide diversity (p) along with associated confidence intervals (CI) for both RAG-1 and ND2. Species are analysed with all samples, and also by particular geographic partitions, for comparisons. 135 Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 136 PORTIK & BAUER* Untangling the Trachylepis variegata complex The average number of within population pairwise differences (K) and nucleotide diversity (p) of RAG-1 is higher in both lineages of T. punctulata than in all T. variegata (Table 2), a result also reflected in the allele network (Fig 3). Levels of genetic variation within T. punctulata from Zimbabwe and Limpopo, T. punctulata from Namibia and the Northern Cape, and all T. variegata are comparable in the mtDNA gene ND2 (Table 2). However, if the samples of T. variegata from northern Namibia are assessed independently of the samples from southern Namibia and South Africa, the levels of genetic diversity in ND2 for these groups drop substantially, indicating that mutational differences between these two regions may be inflating diversity estimates for this gene (Table 2). Overall, across similar geographic ranges, the lineages of T. punctulata exhibit greater genetic diversity. A comparison of p-distances reveals that values are greater for comparisons between T. variegata and either grouping of T. punctulata than for comparisons between T. punctulata groupings. The average p-distances for comparisons of T. punctulata samples from Namibia and the Northern Cape and T. punctulata samples from Zimbabwe and Limpopo are 13.0% and 0.3% based on ND2 and RAG-1 respectively. The average p-distances between T. variegata and T. punctulata samples from Namibia and the Northern Cape are 13.8% and 0.8%, whereas the average p-distances between T. variegata and T. punctulata samples from Zimbabwe and Limpopo are 14.4% and 0.7%, based on ND2 and RAG-1 respectively. Within T. variegata, average p-distances between samples from northern Namibia and samples from southern Namibia and South Africa are 7.2% (ND2) and 0.01% (RAG-1). Morphological data All measured characters fell within the established ranges for Trachylepis variegata and T. punctulata, and specimens exhibited either three (T. variegata) or five keels (T. punctulata) on the dorsal scales (Supplemental Table 2). Although both Branch (1998) and Broadley (2000) reported that T. punctulata may exhibit up to seven keels on a few of the dorsal scales, we did not find more than five dorsal keels on any specimen in the material we examined, although our sample size (T. punctulata, N !9; T. variegata, N !15) is considerably smaller than that of Broadley (2000) (T. punctulata, N !290; T. variegata, N !73). These characters were used to establish identifications of samples for our molecular analyses. DISCUSSION The results of our molecular analyses do not support a sister taxon relationship between T. variegata and T. punctulata, as defined by the morphological boundaries outlined by Broadley (1975, 2000). While we find evidence that T. variegata is supported as a single widespread lineage, T. punctulata is not recovered as a monophyletic assemblage (Fig 2). Our phylogenetic analyses indicate that there are two molecular lineages that can both be classified as T. punctulata based on morphology. While somewhat unexpected, these results may either reflect true diversity within what is considered T. punctulata, or may be the result of a sampling artefact. Broadley (1975) remarked that populations of T. punctulata from the Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 AFRICAN JOURNAL OF HERPETOLOGY 61(2) 2012 137 Northern Cape Province, Botswana, Rhodesia, Zambia and Mozambique differ in several morphological characters from populations in Angola and Namibia, and that the eastern populations may ultimately deserve taxonomic recognition. Our results partially support this division, although we find evidence for the Northern Cape Province sample clustering with samples of T. punctulata from Namibia. Alternatively, these results may stem from a sampling artefact. We cannot determine whether T. punctulata is paraphyletic with respect to T. variegata or whether a deep divergence within T. punctulata produced the two lineages. With additional sampling, resolution at deeper nodes may improve and the monophyly of T. punctulata can be tested more appropriately. It is also possible that the lineages found in our analyses may have diverged rapidly, such that additional sampling will not resolve the polytomy we recovered in our results. Both T. variegata and T. punctulata have been recorded in close geographic proximity in the Usakos area of Namibia, along with putative intergrades between the two forms (Broadley 1975). Although our sampling is not extensive, we include samples of T. variegata (AMB 7165, AMB 7128) and T. punctulata (MCZA 28059, MCZA 28060) from around the Usakos area (Fig 1). We find no evidence of allele sharing occurring between the two forms in this region, nor do we find any evidence of any allele sharing occurring between any samples of T. variegata and either lineage of T. punctulata (Fig 3). Although not conclusive, here we do not find molecular evidence of hybridisation between the two forms, supporting the notion proposed by Broadley (2000) that hybridisation, if occurring at all, is likely limited in scope. Denser sampling from the Usakos region may reveal morphological intergrades, which could then be tested in our molecular framework. The recognition of T. variegata and T. punctulata as distinct species is based on morphology, ecological differentiation and largely allopatric distributions. We find no evidence of hybridisation or allele sharing between either grouping of T. punctulata and T. variegata, and demonstrate with widespread sampling that T. variegata is a monophyletic assemblage. While we do not find molecular evidence of a sister taxon relationship between T. variegata and T. punctulata, our results are likely driven by either a sampling artefact or the presence of an undescribed lineage occurring within the complex. As both scenarios are possible, we conservatively support recognition of T. variegata and T. punctulata as distinct species, and propose the possibility of additional lineages occurring in the T. variegata complex. While we have explored a large geographic area of the T. lacertiformes complex, the molecular relationships between T. chimbana, T. lacertiformes, T. punctulata and T. variegata remain to be tested. The isolated populations of T. lacertiformes in southern Angola are separated from eastern populations by large tracts of deep sand without rock outcrops (Broadley 1975), raising the possibility of additional undescribed lineages within this complex (Fig 1). A particularly interesting area for both molecular and ecological study is southern Angola, where all four described members of the T. lacertiformes complex have been recorded in close geographic proximity, with some species reported in sympatry (Broadley 1975). In addition to resolving relationships of the T. lacertiformes complex, investigation of phylogeographic patterns in widespread lineages of the complex may provide insight into historical processes that could have driven speciation within the group. T. variegata is broadly sympatric with the western rock skink, T. sulcata, and shows a similar genetic break between samples from northern Namibia and samples from southern 138 PORTIK & BAUER* Untangling the Trachylepis variegata complex Namibia and South Africa (Figs. 1 & 2) (Portik et al. 2011). Additional sampling and sequencing of markers may elucidate historical cycles of expansion and contraction, which may have promoted periods of geographic isolation from T. punctulata. These and other hypotheses can be tested in a molecular framework to better understand the evolutionary history of the T. lacertiformes complex and further untangle this historically problematic group. Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 ACKNOWLEDGEMENTS Funding for this project was provided by a National Science Foundation grant (DEB 0515909) and Villanova University. We thank Todd Jackman for advice in preparing this manuscript, and we thank Bill Branch, Marius Burger, Johan Marais and Krystal Tolley for tissue samples. Ross Sadlier, Johan Marais and Stuart Love Nielsen provided assistance in the field. We also thank the authorities in the Republic of Namibia and the Northern, Western and Eastern Cape provinces of the Republic of South Africa permitting the collection and export of samples used in this study. REFERENCES AUERBACH, R.D. 1987. The Amphibians and Reptiles of Botswana. Mokwepa Consultants, Gaborone. BRANCH, W.R. 1998. Field Guide to Snakes and Other Reptiles of Southern Africa. Struik, Cape Town. BRANDLEY, M.C., A. SCHMITZ & T.W. REEDER. 2005. Partitioned Bayesian analyses, partition choice, and the phylogenetic relationships of scincid lizards. Syst. Bio. 54: 373"390. BROADLEY, D.G. 1975. A review of the Mabuya lacertiformis complex in southern Africa (Sauria: Scincidae). Arnoldia Rhod. 7: 1"16. BROADLEY, D.G. 2000. A review of the genus Mabuya in southeastern Africa (Sauria: Scincidae). Afr. J. Herpetol. 49: 87"110. CLEMENT, M., D. POSADA & K.A. CRANDALL. 2000. TCS: a computer program to estimate gene genealogies. Mol. Ecol. 9: 1657"1659. DE WAAL, S.W.P. 1978. The Squamata (Reptilia) of the Orange Free State, South Africa. Mem. nas. Mus. Bloemfontein 11(i"iii): 1"160. DRUMMOND, A.J., B. ASHTON, S. BUXTON, M. CHEUNG, A. COOPER, C. DURAN, M. FIELD, J. HELED, M. KEARSE, S. MARKOWITZ, R. MOIR, S. STONES-HAVAS, S. STURROCK, T. THIERER & A. WILSON. 2011. Geneious v5.4. http://www.geneious.com/ EXCOFFIER, L.G.L. & S. SCHNEIDER. 2005. Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evol. Bioinformatics 1: 47"50. FITZSIMONS, V.F. 1943. The lizards of South Africa. Transvaal Mus. Mem. 1: 1"528. HUELSENBECK, J.P. & F. RONQUIST. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754"755. HUEY, R.B. & E.R. PIANKA. 1977. Patterns of niche overlap among broadly sympatric versus narrowly sympatric Kalahari lizards (Scincidae: Mabuya). Ecology 58: 119"128. JACOBSEN, N.H.G. 1989. A herpetological survey of the Transvaal. Unpubl. Ph.D thesis, University of Natal. MACEY, J.R., A. LARSON, N.B. ANANJEVA & T.J. PAPENFUSS. 1997. Evolutionary shifts in three major structural features of the mitochondrial genome among iguanian lizards. J. Mol. Evol. 44: 660"674. MAYDEN, R.L. 1997. A hierarchy of species concepts: the denouement in the saga of the species problem. Pp. 381"424. In M.F. CLARIDGE, H.A. DAWAH & M.R. WILSON (Eds.) Species: The Units of Biodiversity. Chapman & Hall, London. MAYR, E. 1942. Systematics and the Origin of Species from the Viewpoint of a Zoologist. Columbia University Press, New York. Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 AFRICAN JOURNAL OF HERPETOLOGY 61(2) 2012 139 PORTIK, D.M., A.M. BAUER & T.R. JACKMAN. 2010. The phylogenetic affinities of Trachylepis sulcata nigra and the intraspecific evolution of coastal melanism in the western rock skink. Afr. Zool. 45: 147"159. PORTIK, D.M., A.M. BAUER & T.R. JACKMAN. 2011. Bridging the gap: western rock skinks (Trachylepis sulcata) have a short history in South Africa. Mol. Ecol. 20: 1744"1758. POSADA, D. & T.R. BUCKLEY. 2004. Model selection and model averaging in phylogenetics: advantages of the AIC and Bayesian approaches over likelihood ratio tests. Syst. Bio. 53: 793"808. POSADA, D. & K.A. CRANDALL. 1998. MODELTEST: Testing the model of DNA substitution. Bioinformatics 14: 817"818. RAMBAUT, A. & A.J. DRUMMOND. 2009. Tracer v1.5.0. http://beast.bio.ed.ac.uk/. RONQUIST, F. & J.P. HUELSENBECK. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572"1574. SCHEET, P. & M. STEPHENS. 2006. A fast and flexible statistical model for large-scale population genotype data: applications to inferring missing genotypes and haplotypic phase. Am. J. Hum. Genet. 78: 629" 644. SIMPSON, G.G. 1951. The species concept. Evol. 5: 285"298. STEPHENS, M., N.J. SMITH & P. DONNELLY. 2001. A new statistical method for haplotype reconstruction from population data. Am. J. Hum. Genet. 68: 978"989. TAMURA, K., D. PETERSON, N. PETERSON, G. STECHER, M. NEI & S. KUMAR. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Bio. Evol. 28: 2731"2739. ZWICKL, D.J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. diss., The University of Texas at Austin. Received: 4 April 2012; Final acceptance: 6 August 2012 140 Species Field Number Museum Number T. punctulata AMB 6888 AMB 6898 AMB 6900 AMB 6914 AMB 7608 AMB 7624 KTH 555 MBUR 00322 MBUR 01005 MBUR 01070 MCZ Z 23126 MCZ Z 37898 MCZ Z 37900 MCZ Z 37903 MCZA 27750 MCZA 27711 MCZA 28059 MCZA 28060 MCZA 28073 MCZA 28080 MCZA 27967 MCZ A 38538 MCZ A 38906 MCZ A 38907 MCZ A 38924 MCZ A 38927 AMB 4505 AMB 4586 AMB 4602 CAS 224066 NMN CAS 223991 CAS 223989 NMN NMN PEM T. variegata MCZ R185914 MCZ R184285 NMN NMN MCZ MCZ MCZ MCZ MCZ MCZ MCZ MCZ R 184900 MCZ R185891 MCZ R185892 MCZ R185898 MCZ R185899 CAS 200019 CAS 200040 CAS 200046 Morphological Data Locality X Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Erongo Region, Namibia Kunene Region, Namibia Northern Cape Province, South Africa Limpopo Province, South Africa Limpopo Province, South Africa Limpopo Province, South Africa Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Erongo Region, Namibia Erongo Region, Namibia Hardap Region, Namibia Hardap Region, Namibia Matabeleland North Province, Zimbabwe Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Kunene Region, Namibia Northern Cape Province, South Africa Northern Cape Province, South Africa Northern Cape Province, South Africa X X X X X X X X X X X X Latitude 19 19 19 19 20 19 28 23 22 22 19 19 19 19 19 18 21 21 23 23 18 19 19 19 19 19 28 28 28 39? 41? 41? 41? 59? 41? 23? 04? 38? 38? 51? 43? 43? 40? 37? 20? 54? 54? 37? 37? 37? 37? 48? 48? 40? 40? 20? 57? 20? 08ƒ 00ƒ 00ƒ 00ƒ 28ƒ 02ƒ 51ƒ 15ƒ 28ƒ 28ƒ 33ƒ 02ƒ 02ƒ 57ƒ 46ƒ 29ƒ 57ƒ 57ƒ 33ƒ 33ƒ 54ƒ 48ƒ 29ƒ 29ƒ 26ƒ 06ƒ 31ƒ S S S S S S S S S S S S S S S S S S S S S S S S S S S S 31ƒ S Longitude 14 14 14 14 14 14 21 28 30 30 15 14 14 14 14 13 15 15 16 16 26 14 15 15 14 14 16 17 16 21? 19? 19? 19? 55? 19? 35? 53? 18? 18? 11? 18? 18? 19? 40? 46? 34? 34? 41? 41? 59? 48? 22? 22? 19? 19? 58? 02? 58? 01ƒ 10ƒ 10ƒ 10ƒ 37ƒ 08ƒ 30ƒ 03ƒ 50ƒ 50ƒ 45ƒ 42ƒ 42ƒ 09ƒ 56ƒ 29ƒ 24ƒ 24ƒ 35ƒ 35ƒ 48ƒ 57ƒ 46ƒ 46ƒ 32ƒ 58ƒ 36ƒ E E E E E E E E E E E E E E E E E E E E E E E E E E E E 36ƒ E PORTIK & BAUER* Untangling the Trachylepis variegata complex Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 Supplemental Table 1. ID numbers, species identification and geographic location of specimens sequenced for this study. Species Field Number Museum Number AMB 7128 AMB 7165 AMB 8856 KTH 219 KTH 597 MB 20645 MB 20658 MB 20755 MCZ Z 23162 MCZ Z 23163 MCZ Z 23164 MCZ Z 23165 MCZ Z 37932 MCZ A 38294 MCZ A 38304 MCZ A 38330 MCZ A 38415 MCZ A 38477 MCZ A 38696 NMN NMN NMN PEM PEM MCZ MCZ MCZ MCZ MCZ MCZ MCZ MCZ MCZ MCZ MCZ R185919 R185920 R185921 R185922 R184316 R184352 R184365 R184367 R184761 R184817 R185110 Morphological Data X X X X X X X X X X X Locality Erongo Region, Namibia Erongo Region, Namibia Northern Cape Province, South Northern Cape Province, South Northern Cape Province, South Northern Cape Province, South Northern Cape Province, South Northern Cape Province, South Karas Region, Namibia Karas Region, Namibia Karas Region, Namibia Karas Region, Namibia Kunene Region, Namibia Karas Region, Namibia Karas Region, Namibia Karas Region, Namibia Northern Cape Province, South Karas Region, Namibia Karas Region, Namibia Latitude Africa Africa Africa Africa Africa Africa Africa 22 22 32 32 30 31 30 28 26 26 26 26 17 26 27 27 29 28 27 38? 25? 54? 12? 11? 39? 37? 37? 38? 38? 38? 38? 58? 44? 23? 23? 15? 29? 29? 14ƒ 49ƒ 34ƒ 35ƒ 02ƒ 23ƒ 27ƒ 05ƒ 02ƒ 02ƒ 02ƒ 02ƒ 48ƒ 56ƒ 25ƒ 10ƒ 21ƒ 32ƒ 37ƒ Longitude S S S S S S S S S S S S S S S S S S S 14 14 19 20 18 19 19 21 15 15 15 15 12 17 18 18 16 19 19 43? 27? 02? 00? 04? 20? 21? 40? 09? 09? 09? 09? 34? 13? 29? 29? 54? 56? 13? 39ƒ 44ƒ 06ƒ 59ƒ 04ƒ 33ƒ 00ƒ 26ƒ 04ƒ 04ƒ 04ƒ 04ƒ 50ƒ 16ƒ 31ƒ 30ƒ 47ƒ 35ƒ 20ƒ E E E E E E E E E E E E E E E E E E E AFRICAN JOURNAL OF HERPETOLOGY 61(2) 2012 Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 Supplemental Table 1 (Continued ) Note: AMB, Aaron M. Bauer field number; CAS, California Academy of Sciences; KTH, Krystal Tolley field number; MB, MBUR, Marius Burger field number; MCZ, Museum of Comparative Zoology, Harvard University; NMN, National Museum of Namibia; PEM, Bayworld (Port Elizabeth Museum). Museum abbreviations without indication of specimen registration numbers pending accessions. 141 142 Species Collector Museum PF SC PT Midbody T. punctulata AMB 6888 AMB 6900 MCZA 38538 MCZA 38906 MCZA 38907 MCZA 38924 MCZA 38927 MCZZ 23126 MCZZ 37898 CAS 224066 CAS 223991 MCZR 184900 MCZR 185891 MCZR 185892 MCZR 185898 MCZR 185899 MCZR 185914 MCZR 184285 S S S S S S S S S AMB 4505 AMB 4586 AMB 4602 AMB 6914 MCZA 38294 MCZA 38304 MCZA 38330 MCZA 38415 MCZA 38477 MCZA 38696 MCZZ 23162 MCZZ 23163 MCZZ 23164 MCZZ 23165 MCZZ 37932 CAS 200019 CAS 200040 CAS 200046 CAS 223989 MCZR 184352 MCZR 184365 MCZR 184367 MCZR 184761 MCZR 184817 MCZR 185110 MCZR 185919 MCZR 185920 MCZR 185921 MCZR 185922 MCZR 184316 S S S S S S S S S S S S S S S T. variegata 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 31 32 34 31 32 31 32 35 32 32.291.4 32 31 34 32 31 31 32 32 32 34 32 32 33 33 31 32.191.0 SVL 41.0 51.5 48.0 51.0 44.5 41.5 45.0 51.5 51.0 47.294.3 41.0 43.5 50.5 37.0 48.0 44.5 50.0 38.5 49.0 43.5 44.5 55.5 41.0 43.0 40.5 44.795.0 Ear lobules Dorsal keels Lamellae 4th finger Lamellae 4th toe 3"4 3 4 3"4 3 4 3 2"3 3 2"4 2 3 2"3 3 3 3 3 2 4 3 2"3 2"3 2 2 2"3 2"4 5 5 5 5 5 5 5 5 5 5 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 15 16 16 16 14 17 15 16 14 15.491.0 15 15 16 16 15 16 16 16 15 15 16 16 18 16 17 15.990.8 22 24 21 23 21 22 21 20 20 21.691.3 23 20 24 22 22 23 25 21 22 24 23 22 23 24 22 22.791.3 Note: Measurements and abbreviations are as follows: snout-vent length (SVL), midbody scale rows (Midbody), number of keels on dorsal scales, number of ear lobules, number of lamellae beneath fourth finger, number of lamella beneath fourth toe, arrangement of prefrontals (PF, in contact, C, or separated, S), number of supraciliaries (SC), and number of pretemporals (PT). All specimens measured are included in the genetic analysis. PORTIK & BAUER* Untangling the Trachylepis variegata complex Downloaded by [University of California, Berkeley] at 09:58 31 October 2012 Supplemental Table 2. Summary of morphological measurements.